Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Similar documents
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

SUPPLEMENTARY INFORMATION

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1.

Supplemental Table I.

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

SUPPLEMENTARY INFORMATION

Supplemental Figure 1

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

SUPPLEMENTARY INFORMATION

Supplemental Figure Legends

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

D CD8 T cell number (x10 6 )

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Nature Medicine doi: /nm.3957

SUPPLEMENTARY FIGURES

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies

Supplementary. presence of the. (c) mrna expression. Error. in naive or

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity

NK cell flow cytometric assay In vivo DC viability and migration assay

Supporting Information Table of Contents

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Figures

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):

effect on the upregulation of these cell surface markers. The mean peak fluorescence intensity

Supplementary Figure 1

Nature Medicine: doi: /nm.3922

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Materials

Supplementary Materials for

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

SUPPLEMENTARY METHODS

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

SUPPLEMENTARY MATERIAL

Optimizing Intracellular Flow Cytometry:

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis

Supporting Information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

SUPPLEMENTARY INFORMATION

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis

Supplementary Data Table of Contents:

Supplementary Figure 1 IL-27 IL

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Supplementary Figure 1

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supporting Information

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Eosinophils! 40! 30! 20! 10! 0! NS!

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Supplementary Information:

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

CXCL11-dependent induction of FOXP3- negative regulatory T cells suppresses autoimmune encephalomyelitis

Lee et al. Molecular Neurodegeneration (2016) 11:54 DOI /s

The Ying and Yang of IFN-γ in Autoimmunity

Pearson r = P (one-tailed) = n = 9

Quantitative PPARγ expression affects the balance between tolerance and immunity

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Peli1 negatively regulates T-cell activation and prevents autoimmunity

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2

Supporting Information

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Figures

Supplemental Information. IRF-5 Promotes Cell Death in CD4 T Cells. during Chronic Infection

Transcription:

Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of C7BL/6J (WT) mice Supplemental Table. EAE clinical parameters of f S1PR1(SA) mice Supplemental Table 3. EAE clinical parameters of WT T H 17-adoptive transferred WT mice Supplemental Table. EAE clinical parameters of S1PR1(SA) T H 17 transferred WT mice Supplemental Table. EAE clinical parameters of WT T H 1-adoptive transferred WT mice Supplemental Table 6. EAE clinical parameters of S1PR1(SA) T H 1 transferred WT mice Supplemental Table 7. EAE clinical parameters of S1PR1(SA) mice with anti-ccr6 antibody treatment Supplemental Table 8. Primers for SYBRGreen quantitative PCR Supplemental Figure 1. The expression of S1P receptors in splenic CD + T cells Supplemental Figure. EAE disease incidence of WT and S1PR1(SA) mice following Supplemental FTY7 treatment Supplemental Figure 3. Splenic lymphocyte counts in WT and S1PR1(SA) EAE mice Supplemental Figure. Gating strategy of CNS immune cells by multi-dimensional flow cytometry Supplemental Figure. The profile of CNS-infiltrating lymphocytes in WT and S1PR1(SA) EAE mice Supplemental Figure 6. The profile of CNS-infiltrating myeloid cells in WT and S1PR1(SA) EAE mice

Supplemental Figure 7. S1PR1(SA) mice with established EAE were refractory to FTY7 treatment. Supplemental Figure 8. The functions of CNS-infiltrating T H cells in WT and S1PR1(SA) EAE mice Supplemental Figure 9. The expression of FOXP3 and IFNγ in CNS-infiltrating CD + CCR6 + T lymphocytes Supplemental Figure 1. FTY7 suppressed CCR6 + cell generation both in vivo and in vitro. Supplemental Figure 11. Control IgG had no significant effects on the improvement of EAE clinical score.

Supplemental Table 1. EAE clinical parameters of C7BL/6J (WT) mice following immunization with MOG 3- peptide. WT (C7BL6/J) Vehicle WT (C7BL6/J) FTY7 p Value Incidence 1% (1/1) % (/1).1 Onset (days after immunization) 1 ±. 17 ± 3.1.3 Maximum score 3. ±.3 1.7 ±.. Score at Peak EAE.7 ±.67.7 ±1.6.13 C.D.I. 37.3 ±.3 7.±9.9. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table. EAE clinical parameters of f S1PR1(SA) mice following immunization with MOG 3- peptide. S1PR1(SA) Vehicle S1PR1(SA) FTY7 p Value Incidence 1%(1/1) 83% (1/1) n.s. Onset (days after immunization) 13 ±1.9 1 ±.7 n.s. Maximum score 3.9 ±.9.6 ± 1..11 Score at Peak EAE 3. ±.8. ± 1.36.18 C.D.I..8±1.73 3.17±.3.39 p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

Supplemental Table 3. EAE clinical parameters of C7BL/6J (WT) mice following adoptive transfer of IL-3-polarized (T H 17) WT splenocytes. WT T H 17 WT T H 17 Vehicle FTY7 p value Incidence 8/1(8%) 6% (6/1) n.s. Onset (days post transfer) 9.6 ± 1.69 19.83 ± 8.86.13 Maximum score. ± 1.3 1.6 ± 1.1 n.s. Score at Peak EAE. ± 1.33 1.3±1. n.s. C.D.I. 39.7±6.39 16.8±.8. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table. EAE clinical parameters of S1PR1(SA) mice following adoptive transfer of IL-3-polarized (T H 17) S1PR1(SA) splenocytes. S1PR1(SA)T H 17 S1PR1(SA)T H 17 Vehicle FTY7 p value Incidence 73% (11/1) 87% (13/1) n.s. Onset (days post transfer) 8.9 ±.83 1. ± 1.98. Maximum score 3.1 ±. 3.± 1.1 n.s. Score at Peak EAE.7 ±1.83.6 ±1.3 n.s. C.D.I. 6. ± 7.9 6.7 ± 31.78 n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

Supplemental Table. EAE clinical parameters of C7BL/6J (WT) mice following adoptive transfer of IL-1-polarized (T H 1) WT splenocytes. WT T H 1 WT T H 1 Vehicle FTY7 p value Incidence 6% (6/1) %(/1) n.s. Onset (days post transfer) 1 ± 1.7 13.6 ± 9.87 n.s. Maximum score 1.3 ± 1.16 1. ± 1. n.s. Score at Peak EAE 1. ±1.1.8±1.3 n.s. C.D.I. 17.7± 1.99 1.1± 1.31 n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table 6. EAE clinical parameters of S1PR1(SA) mice following adoptive transfer of IL-1-polarized (T H 1) S1PR1(SA) splenocytes. S1PR1(SA)T H 1 S1PR1(SA)T H 1 Vehicle FTY7 p value Incidence 3% (8/1) 67% (1/1) n.s. Onset (days post transfer) 1. ± 1.69 1. ± 3.88 n.s. Maximum score 1. ± 1. 1. ± 1. n.s. Score at Peak EAE 1.3 ±1. 1. ±1.1 n.s. C.D.I. 17. ± 3.98 1.13 ±.37 n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

Supplemental Table 7. EAE clinical parameters of S1PR1(SA) mice following immunization with MOG 3- peptide and FTY7 treatment. S1PR1(SA) FTY7 treatment p value Control IgG Anti-CCR6 Incidence 1% (7/7) 8% (6/7) n.s. Onset (days after immunization) 1 ± 1. 17 ± 1..36 Maximum score.9 ±.69.1 ± 1.3 n.s. Score at Peak EAE.9 ±.69.1 ± 1.3 n.s. C.D.I. ±. 1 ± 7.8.16 Control IgG and Anti-CCR6 mab (1µg per mice) were administrated twice as indicated. p<., Mann-Whitney U-test. n=7/arm. C.D.I.=Cumulative disease index. Supplemental Table 8. Primers for SYBRGreen quantitative PCR (synthesized in Stanford PAN Facility) Transcript Forward primer Reverse primer Il17a TACCTCAACCGTTCCACGTC TTTCCCTCCGCATTGACACA S1pr1 GTGTAGACCCAGAGTCCTGCG AGCTTTTCCTTGGCTGGAGAG S1pr CCAAGGAGACGCTGGACATG TGCCGTAGAGCTTGACCTTG S1pr3 GCAACTTGGCTCTCTGCGAC GACGATGGTCACCAGAATGG S1pr GTGTATGGCTGCATCGGTCTGTG GGATTAATGGCTGAGTTGAACACG S1pr GTGGCGCTCGCCGCGTCGGTG GAAGGTGTAGATGATGGGATTCAG

Supplemental Figure 1 Relative Abundance...1.1.. S1pr1 WT p=. S1PR1(SA) Relative Abundance..1.1.. S1pr WT p=.9 S1PR1(SA) Relative Abundance.1.8.6... S1pr3 WT p=.9 S1PR1(SA) Relative Abundance. 1. 1... S1pr WT p=.31 S1PR1(SA) Relative Abundance...3..1. S1pr WT p=.9 S1PR1(SA) Relative RNA expression of S1P receptors in splenic CD + T cells from naïve WT (C7BL/6J) and S1PR1(SA) mice. Total RNA was isolated from splenic CD + T cells and analyzed by SYBRGreen quantitative PCR. Data was normalized with RNA expression of β- actin (n= per group, Mean± SEM, p<., -tailed Student s t-test).

Supplemental Figure % Incidence of EAE 1 7 1 1 Time after immunization (d) S1PR1(SA) mice showed higher incidence and early onset of EAE compared to C7BL/6J (WT) mice following FTY7 treatment. MOG 3- -immunized C7BL/6J (WT) and mice carrying phosphorylation defective S1PR1 (S1PR1(SA)) (females, 8-1 weeks) were treated with either vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily intraperitoneal injections. Mice were followed clinically throughout EAE disease course. n= 1-1 mice/arm.

Supplemental Figure 3 A B C D E CD3 + CD + CD8 + [ 3 H] thymidine incorporation (1 c.p.m) 3 1 1 MOG (µg/ml) Cell number ( 1 7 ) 6 Cell number ( 1 7 ) 3 1 Cell number ( 1 7 ). 1. 1... Cell number ( 1 7 ) 8 6 CD11b + F G H I J IL17A + IFNγ + FOXP3 + IFNγ + IL17A + Cell number ( 1 ) 8 6 Cell number ( 1 ) 3 1 Cell number ( 1 ) 1 1 Cell number ( 1 ) 1 1 Relative Abundance Il17a.1.8.6... FTY7 treatment decreased lymphocyte counts in the spleens of both WT and S1PR1(SA) EAE mice. MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) at the day of immunization by daily i.p injection. Splenocytes were isolated at D8 post-immunization. (A) Immune cells proliferation in response to ex vivo MOG 3- reactivation was measured by [ 3 H] thymidine incorporation (c.p.m., counts per minute). The numbers of CD3 + (B), CD + (C), CD8 + (D), and CD11b + (E) cells were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of splenocytes by the percentage of gated cells. Cells were stimulated with PMA (ng/ml) and ionomycin (ng/ml) for h and intracellular staining was performed to measure IL-17A (F, I), IFN-γ (G, I), and FOXP3 (H) expression among CD + T cells. CD + T cells were isolated from splenocytes of MOG 3- -immunized EAE mice at D8. The expression of IL-17A RNA transcripts (J) in the CD + T cells was analyzed by SyBrGreen quantitative PCR and normalized to β-actin. (n= per group, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure A B C D E F G H I J Gating strategy of CNS immune cells by multi-dimensional flow cytometry (A) CD low and CD hi cells were gated from live leukocytes. CD hi cells were gated to CNSinfiltrating myeloid cells (CD hi CD11b + ) and CD3 + cells (B). CD3 + cells were then gated to CD + and CD8 + T cells (C). CD low cells were gated to microglia cells (CDl o CD11b + ) (D). Infiltrating myeloid cells (CD hi CD11b + ) were further gated to neutrophils/monocytes (CD hi CD11b + Gr1 + ) (E), dendritic cells (CD hi CD11b + CD11c + ) (F), eosinophils (CD hi CD11b + SiglecF + ) (G). The effector functions of CD + T cells were gated by CCR6, IL- 17A, IFN-γ, and FOXP3 markers (H-J).

Supplemental Figure A B C CD hi CD3 + Cell number ( 1 ) 1 1 Cell number ( 1 ) 8 6 Cell number ( 1 ) CD + 6 D Cell number ( 1 ). 1. 1... CD8 + E % of total cells 8 6 CD8 + The profile and cell counts of CNS-infiltrating lymphocytes in WT and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. Numbers of CD hi (A), CD3 + (B), CD + (C), CD8 + (D) cells and percentage of CD8 + (E) cells were quantified by flow cytometrty. The cell number was calculated by multiplying the total viable cell number of splenocytes by the percentage of gated cells. Data represent three independent experiments (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure 6 A B C D E % of total cells CD hi CD11b + 6 % of total cells 1 8 6 CD lo CD11b + % of total cells CD11b + CD11c + 1 1 % of total cells 3 1 CD11b + Gr1 + % of total cells CD11b + SiglecF + 6 F G H I J Cell number ( 1 ) 1 1 CD hi CD11b + Cell number ( 1 ) CD lo CD11b + 1 1 Cell number ( 1 ) CD11b + CD11c +. 1. 1... Cell number ( 1 ) 3 1 CD11b + Gr1 + Cell number ( 1 ) CD11b + SiglecF + 1. 1... The profile and number of CNS-infiltrating myeloid cells in C7BL/6J (WT) and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. The percentage and number of CNS-infiltrating myeloid cells (CD hi CD11b + ) (A, F), microglia cells (CD lo CD11b + ) (B, G), dendritic cells (CD hi CD11b + CD11c + ) (C, H), monocytes/neutrophils (CD hi CD11b + Gr1 + ) (D, I), and eosinophils (CD hi CD11b + SiglecF + ) (E, J) were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent three independent experiments (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure 7 A Mean clinical score 3 1 1 1 3 3 39 Time after immunization (d) B C D E % of total CD + cells 1 8 6 IL17A + % of total CD + cells 1 1 IFNγ + % of total CD + cells 1 1 FOXP3 + % of total CD + cells 1 1 CCR6 + S1PR1(SA) mice with established EAE were refractory to FTY7 treatment. (A) Mean clinical score of MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) mice (females, 8-1 weeks) treated with either vehicle (1% cyclodextrin in PBS ) or FTY7 (.mg/kg) by daily i.p. injections when mice first displayed an EAE clinical score of. Arrows (!WT and! S1PR1(SA)) indicate the time of initiation of therapy. p<., Mann-Whitney U-test. This experiment was performed times with n= 9-1 mice/ arm. (B-E) MOG 3- - immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) at the day of immunization by daily i.p. injections. Immune cells from the spleen were collected when EAE clinical scores reached -3. Cells were stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and intracellular staining was performed to measure the expression of IL-17A (B), IFN- γ (C), FOXP3 (D) and CCR6 (E) among CD + T cells. This experiment was performed three times with n mice/ arm, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test.

Supplemental Figure 8 A B C Cell number ( 1 3 ) 3 1 IL17A + Cell number ( 1 3 ) 6 IFNγ + Cell number ( 1 3 ) 1 8 6 FOXP3 + The functions and cell counts of CNS-infiltrating T H cells in WT and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. Cells were stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and intracellular staining was performed to measure the expression of IL-17A (A), IFN- γ (B), and FOXP3 (C) among CD + T cells. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent three independent experiments (n 6, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure 9 A B % of total CCR6 + cells 1 1 FOXP3 + % of total CCR6 + cells 1 1 IFNγ + The percentage of FOXP3-positive and IFNγ-positive cells among CCR6-positive CNSinfiltrating CD T lymphocytes MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections at the day of immunization. Immune cells from the brains and spinal cords were collected when mice display an EAE score of to 3. CNS immune cells were re-stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and then cells were labeled with antibodies against CD, CCR6, IFN-γ, and FOXP3 antibodies. Percentage of FOXP3 + (A) and IFN-γ + (B) cells in CD + CCR6 + population were quantified by flow cytometry (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure 1 A B C D CCR6 + CD + CCR6 + CCR6 % of total CD + T cells 1 1 Cell number ( 1 ) 3 1 WT_PBS SA_PBS MFI 1 1 % of total CD T cells 3 1 - D-D D3-D CCR6 + FTYp - D-D D3-D FTYp WT S1PR1(SA) FTY7 suppressed CCR6 + cell generation both in vivo and in vitro. MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections up to D8 postimmunization. Splenocytes were harvested and labeled with anti-cd and CCR6 antibodies. The percentage (A), total number (B), and MFI (C) of CCR6 + cells among CD + T cells from the spleen were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent two independent experiments (n=, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test) CD + T cells were isolated from spleens of naïve C7BL/6J (WT) and S1PR1 (SA) mice and activated in vitro with anti-cd3 (µg/ml) and anti-cd8 (µg/ml) for days in RPMI16 media supplemented with IL-6 (ng/ml), IL-3 (ng/ml), TGF-β (1ng/ml) in the presence of FTYp (1µM). Cells were stained with anti-ccr6 antibody and percentage of CCR6 + cells (D) among CD + T cells was analyzed by flow cytometry. This experiment was performed three times (n=3, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure 11 Mean clinical score 3 1 _IgG 1 1 Time after immunization (d) Control IgG had no significant effects on the improvement of EAE clinical score. Mean clinical score ± SEM of MOG 3- -immunized S1PR1(SA) mice (females, 8-1 weeks) treated with FTY7 (.mg/kg) by daily i.p. injections. Arrow indicates time of initiation of FTY7 therapy. Additionally, mice were also i.p. injected with IgG control (1µg per mouse) at D and D8. Arrowheads indicates time of antibody injection (n per arm p<., Mann- Whitney U-test).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback