Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Similar documents
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

perk/erk STAT5B

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

SUPPLEMENTARY INFORMATION

a b c Physical appearance of mice Lean mass Adipocyte size d e f

AMPK is essential for energy homeostasis regulation and glucose sensing by POMC and AgRP neurons

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Supplementary Figure 1

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

SUPPLEMENTARY FIGURE LEGENDS

! acts via the autonomic nervous system. ! maintaining body weight within tight limits. ! ventromedial (VMN) ! arcuate (ARC) ! neuropeptide Y (NPY)

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

CNS Control of Food Intake. Adena Zadourian & Andrea Shelton

SUPPLEMENTARY INFORMATION

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Cell to Cell Communication

The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin

Supporting Information

Supplementary Figure 1.

SUPPLEMENTARY INFORMATION

Neural pathways controlling homeostatic and hedonic feeding in rats on free-choice diets van den Heuvel, J.K.

SUPPLEMENTARY INFORMATION

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg

Supplementary Table 1. List of primers used in this study

BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

Ophthalmology, Radiation Oncology,

Homeostasis Through Chemistry. The Endocrine System Topic 6.6

Dep. Control Time (min)

Supplementary Materials for

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

SUPPLEMENTARY INFORMATION

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

2.5. AMPK activity

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supporting Online Material for

Cell to Cell Communication

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

SUPPLEMENTARY FIGURES

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Obesity in aging: Hormonal contribution

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph

SUPPLEMENTARY INFORMATION

Supplementary legends

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Neonatal ghrelin programs development of hypothalamic feeding circuits

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Ghrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Internal Regulation II Energy

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1

Hypoxia-Inducible Factor Directs POMC Gene to Mediate Hypothalamic Nutrient Sensing and. Energy Balance Regulation.

Royal jelly improves mental health

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Insights from Rare Obesity Disorders

SUPPLEMENTARY INFORMATION

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Supplementary Information

Hypothalamic Autophagy and Regulation of Energy Balance

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

Transcription:

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for AMPK!2 (green) and POMC (red) expression in the hypothalami of control and POMC!2KO mice. Colocalisation of typical nuclear staining of AMPK!2 is seen in POMC neurons in control section (indicated by white arrows) and no colocalization is seen in POMC!2KO section. (B) mmunofluorescence analysis for AMPK!2 (red) and AgRPCreYFP (green) expression in the hypothalami of control and AgRP!2KOYFP mice. Colocalisation of typical nuclear staining of AMPK!2 is seen in AgRP neurons in control section (indicated by white arrows) and no colocalization is seen in AgRP!2KOYFP section. Confocal images of representative ARC fields are shown and are typical of results from 3 mice of each genotype. Scale bars: 1 µm. (C) Quantification of deletion of AMPK!2 in POMC!2KO and AgRP!2KO neurons. AMPK!2 staining was assessed in at least 5 POMC or AgRP neurons from 3 mice of each genotype. Results are expressed as percentage of cells in which AMPK!2 expression was absent and are means " SEM. Supplemental Figure 2. Unaltered neuropeptide release in hypothalamic explants from POMC!2KO and AgRP!2KO mice and normal anterior pituitary hormone gene expression in POMC!2KO mice. (A)!-MSH release in control and POMC!2KO hypothalamic explants (n = 15 per genotype). (B) AgRP and (C) NPY release in control and AgRP!2KO hypothalamic explants (n = 8 per genotype). (D) Pre-pro-opiomelanocortin (POMC), growth hormone (GH) and thyroid stimulating hormone beta subunit (TSH#) mrna expression in control and POMC!2KO pituitaries assessed by quantitative RT-PCR, n = 6-1. Probes for GAPDH were used to adjust for total RNA content. All values are mean " SEM.

Supplemental Figure 3. Glucose homeostasis in POMC!2KO and AgRP!2KO mice. (A) Glucose tolerance in 12-week old male control and POMC!2KO mice on chow diet, n = 16. (B) Glucose tolerance in male control and POMC!2KO mice after 18 week exposure to HFD, n = 11-15. (C) Glucose tolerance in 12-week old male control and AgRP!2KO mice, n = 5-7. (D) nsulin tolerance in 12-week old male control and AgRP!2KO mice, n = 12-2. All values are mean ± SEM. * P <.5. Supplemental Figure 4. AgRP neuronal anatomy is normal in AgRP!2KO mice. (A) n situ hybridization for AgRP mrna in ARC of control and AgRP!2KO mice. Representative sections from 3 mice for each genotype are shown. (B) mmunoreactivity for AgRP in ARC of control and AgRP!2KO mice. Representative sections from 3 mice for each genotype are presented. Population size and distribution (C and D) for AgRP neurons within the ARC in control and AgRP!2KO mice (n = 2-3). AgRP somatic area (E) and diameter (F) in control and AgRP!2KO mice. A minimum of 1 neurons were analysed per group. 3V, 3 rd ventricle. Scale bars, 5 $m. All values are mean " SEM.

Supplemental Table 1. Body length, bone mineral content and biochemical parameters in AMPK!2 mutant mice. POMC!2KO!1HetPOMC!2KO AgRP!2KO Nose/anus length (cm) 9.4 ±.1 9.4 ±.1 9.6 ±.1 9.3 ±.2 9.1 ±.3 (8) (8) (8) (8) Bone mineral content.51 ±.54 ±.53 ± ND ND (g/cm 2 ).1 (8).1 (8).1 (8) Randomly fed blood 8.1 ±.2 8.2 ±.2 8.1 ±.4 6.8 ±.2 6.8 ±.2 glucose (mmol/l) (27) () (12) (15) (14) Fasted blood glucose 5.7 ±.3 5.8 ±.5 5.3 ±.4 4.7 ±.2 4.3 ±.2 (mmol/l) (24) (23) (18) (16) (17) nsulin (ng/ml).149 ±.173 ± ND.155 ±.186 ±.15.52.19.19 Adiponectin ($g/ml) 4.8 ±.6 4.5 ±.6 ND 4. ±.5 3.1 ±.3 (6) Corticosterone (ng/ml) 11.1 ± 1.9 (6) 9.2 ± 1.9 ND ND ND T4 ($g/dl) 6.1 ±.3 6.3 ±.7 ND 3.4 ±.2 3.6 ±.3 (6) (6) Data are expressed as mean ± SEM. The number of mice per group is shown in parenthesis. ND, not determined.

Supplemental Table 2. The biophysical properties of ARC AgRP-expressing neurons in control and AgRP!2KO mice. AgRP!2KO Membrane potential (mv) -46 ± 1 (26) -51 ± 1 (19)* nput resistance (G%) 2.5 ±.3 (23) 2.8 ±.3 (17) Spike firing frequency (Hz) 2.1 ±.4 (26) 2.8 ±.5 (19) Data are expressed as mean ± SEM. The number of neurons per group is shown in parenthesis. * P <.5.

Supplemental Figure 1 A B POMCα2KO C AMPKa2 deletion (%) 1 9 8 7 6 5 4 3 2 1 POMCα2KO

Supplemental Figure 2 A 15 B 15 Basal α-msh release (pg/hypothalamus/45 mins) 1 1 75 5 Basal AgRP release (pg/hypothalamus/45 mins) 1 1 75 5 POMC α2ko AgRP α2ko C 1 D Basal NPY release (pg/hypothalamus/45 mins) 75 5 mrna expression relative to control (%) 15 1 5 POMCα2KO POMC GH TSHβ

Supplemental Figure 3 A Blood glucose (mmol/l) 2 15 1 5 POMCα2KO B Blood glucose (mmol/l) 2 15 1 5 * HFD POMCα2KO HFD * 15 3 6 12 15 3 6 12 Time after injection (min) Time after injection (min) C Blood glucose (mmol/l) 15 1 5 D Blood glucose (% of fasting levels) 1 75 5 15 3 6 12 Time after injection (min) 15 3 6 12 Time after injection (min)

Supplemental Figure 4 A B 3V 3V 3V 3V C D AgRP cell count (total) 6 5 4 3 2 1 AgRP α2ko AgRP cell count 12 11 1 9 8 7 6 5 4 3 2 1 1 2 3 4 5 ARC section E F 14 14 AgRP cell area (µm 2 ) 12 1 8 6 4 2 AgRP α2ko AgRP cell diameter (µm) 12 1 8 6 4 2 AgRP α2ko

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback