IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p<.1 6 -/- 3 6 9 1 15 18 1 Days after inoculation G isotype CD+TCRβ+ LPL IL-17 Supplemental Figure 1: Characterization of Gnas CD CD and CD8 T cells Splenocytes from 8-week old and Gnas CD mice were labeled with CD Pacific blue, TCRβ percp-cy5.5, CD PE-cy7, CD6L PC and CD5 lexa 88 bs. () The number of CD T cell and () the percentage of effector and memory CD T cells (CD high CD6L low ) in Gnas CD spleens are comparable to those in spleens. The cells were gated on CD + TCRβ + T cells. (C) Comparable frequencies of CD5 + CD T cells in the two strains. Data is representative of two independent experiments. Splenocytes from 8-week old and Gnas CD mice were labeled with CD8a Pacific blue, TCRβ percp-cy5.5, CD PE-cy7, CD6L PC. (D) The CD8 T cell numbers and (E) the proportions of effector memory CD8 T cells (CD high CD6L low ) in Gnas CD spleens are comparable to those in spleens. The cells were gated on CD8 + TCRβ + T cells. (F) acterial counts in fecal homogenates from or Gnas ΔCD mice infected orally with C. rodentium (x1 8 CFU) were determined at various time points as described previously (Dann, S.M., et al. 8. J Immunol 18:6816-686). Data are mean ± s.e.m, n=3, from a representative experiment out of three that were performed. * p value was calculated by two way NOV. (G) The reduced frequency of IL-17 + CD + LPL or IFNγ + CD + LPL in Gnas ΔCD mice in C. rodentium infection. LPLs were isolated from the colons of or Gnas ΔCD mice at day 8 post-infection as described elsewhere (Mucida, D, et al. 7. Science 317:56-6). riefly, the colonic tissues from the host mice that received either or Gnas ΔCD T cells (n=3) were pooled, cut and then digested by collagenase (type VIII; Sigma). To collect the LPL cells, the cell suspensions were carefully layered onto a % and 8% discontinuous Percoll solution and centrifuged for min at 1,g. LPL cells were recovered from the interface and were stimulated with PM/ionomycin for h. The intracellular cytokines in CD + TCRβ + -gated LPL were determined (FCS). Data of a representative mouse/group are displayed.
Supplemental Figure. C Relative mrn expression 1. 1..8.6... PDE1 PDE1 PDE1C PDE PDE3 PDE3 PDE PDE PDEC PDED PDE5 PDE7 PDE7 PDE8 PDE8 PDE9 PDE1 PDE11 fmol cmp /million cells 5 15 1 5 basal ** Control PDE1 inhibitor PDE inhibitor PDE3 inhibitor PDE inhibitor PDE7 inhibitor fmol cmp /million cells 3 1 + forskolin ** ** Control PDE1 inhibitor PDE inhibitor PDE3 inhibitor PDE inhibitor PDE7 inhibitor Supplemental Figure : PDE inhibition increases cmp levels in CD T cells () CD T cells were enriched from splenocytes using CD-negative selection immunomagnetic beads. Total RN was extracted for qpcr analysis. Expression of mrn levels of PDE isoforms (mean ± s.e.m.) was normalized to 18S rrn housekeeping gene and expressed relative to PDE (the highest expressed PDE in CD T cells). () CD T splenocytes were treated for 3 min with PDE typespecific inhibitors as follows: PDE1 inhibitor 8-MM-IMX, 3 µm; PDE inhibitor, EHN, 1 µm; PDE3 inhibitor, milrinone, 1 µm; PDE inhibitor, rolipram, 1 µm and PDE7 inhibitor, RL-581, 3 µm, and the cmp levels determined. Data shown are from independent experiments (Mean ± s.e.m.), p<.6 vs. control treatment. (C) The enriched CD T cells were incubated with PDE inhibitors for 3 min and then with forskolin (1 µm) for 1 min. The cmp levels were measured as described in Experimental procedures.
Supplemental Figure 3. isotype efore fter CD CD8 IL-17 (pg/ml ) 35 3 5 15 1 5 n.s. CD + depleted splenocytes from mice CD + depleted splenocytes from mice IFNγ (ng/ml ) 3..5. 1.5 1..5. n.s. +OV - OV +OV - OV C IL-17 (pg/ml ) 3 1 n.s. IFNγ (ng/ml ).. 1.8 1.5 1. 1..8.5.. n.s. MDC MDC +OV - OV +OV - OV Supplementary Figure 3: Deletion of Gαs in CD8 and MDCs do not affect OV-specific CD T cells responses. () Depletion of CD+ cells in splenocytes from and Gnas CD mice. The CD + cells were labeled by anti-cd biotin bs and depleted from splenocytes by biotin+ selection kit. The cells before and after CD depletion were stained with anti-cd PC and anti-cd8a PE antibodies. () Effect of CD + cell depleted splenocyte on differentiation of OT- CD T ells. The naïve OT- CD T cells (.5 1 5 cells) were enriched by magnetic beads (CD8 - - CD11c - CD11b - CD5 - ) and co-cultured for 5 days with or Gnas CD splenocytes (1.5 1 5 cells) that were depleted of CD + cells in the presence or absence of class II-derived OV peptide (1 µg/ml). Cytokine concentration (IL-17 and IFNγ) in the supernatant was detected by ELIS (mean ± s.e.m, n=3). (C) Effect of Gnas CD MDCs cells on differentiation of OT- cells. The naïve OT- cells (.5 1 5 cell) were enriched and co-cultured for 5 days with or Gnas CD MDCs (1.5 1 5 cell) in presence or absence of OV peptide (1 µg/ml). Cytokine concentrations (IL-17 and IFNγ) in the supernatant were detected (ELIS) (mean ± s.e.m, n=3).
Supplementary Figure : Sorted cells Sorted cells after 5 days culture % of Max 8.5% 9.5 % % of Max 3.8 %.5 % Foxp3 Foxp3 n.s. IL-1 (ng/ml) 3 1 C Teff only Teff: 16:1 8:1 :1 :1 % of Max 1.1%. % 3.9 % 5.1 % 5.6 % 6.% % 6 % 5.6% CFSE Supplementary Figure : Gnas CD CD T cells do not regulate cell differentiation. () Stability of Foxp3 in and Gnas CD T regulatory cells in vitro. Splenic cells (CD + CD5R low CD5 + ) were sorted from or Gnas CD mice and co-cultured for 5 days with effector CD T cells (CD + CD5R high CD5 - ) from congenic CD5.1 mice for 3 days at different ratios in the presence of anti- CD3 (1µg/ml) antibody and irradiated CD5.1+ splenocytes (3 rad). The cells (CD5. + ) before and after cultured in vitro were gated and intracellular Foxp3 expression were analyzed by FCS. () IL-1 production in and Gnas CD T reg cells. The sorted naïve and Gnas CD CDT cells were differentiated into cells in vitro (TGFβ 1 ng/ml+hil- 1 U/ml) for days. The cells were stimulated with anti-cd3/8 antibodies for h and IL-1 was measured in the supernatants (ELIS). Results are showed in mean ± s.e.m in triplicates. (C) Suppressive function of and Gnas CD cells in vitro. Splenic cells (CD + CD5R low CD5 + ) were sorted from or Gnas CD mice and co-cultured for 3 days with CFSE (5 µm) labeled effect T cells (CD + CD5R high CD5 - ) from congenic CD5.1 mice for 3 days at different ratios in the presence of anti-cd3 antibody (5 µg/ml) and irradiated splenocytes (3 rad). The effector CD T cells (CD5.1 + ) were gated and the CFSE dilution was analyzed (FCS).
Supplemental Figure 5. 8r ( μm) 8r (6.5 μm) 8r (1.5 μm) 8r (5 μm) 8r (5 μm) IFNγ IL-17 isotype +8r-cMP +8r-cMP IFNγ Th polarization IL- C isotype +8r-cMP +8r-cMP IFNγ polarization Foxp3 Supplementary Figure 5: cmp has divergent effects on Th subset differentiation () 8r-cMP increase Th17 differentiation in Gnas CD CD T cells in a dose-dependent manner. The sorted naïve CD T cells were cultured under Th17 differentiation condition (IL-6 and TGFβ, anti-cd3 and anti-cd8 bs and neutralized bs for IL- and IFNγ) with the indicated concentration of 8r-cMP for days. The cells were further stimulated by PM and inomycin for h in presence of GolgiStop. (-C) Cyclic MP does not affect Th and differentiation in vitro. FCS-sorted naive CD T cells from or Gnas CD spleens were cultured for days under Th () or (C) differentiation conditions as described in Experimental procedures with and without 8r-cMP (5 µm). CD T cells were then stimulated with PM/ionomycin for h and the intracellular cytokines IL-, IFNγ and Foxp3 were determined (FCS). Data is representative of independent experiments with similar results.
Supplemental Figure 6. 5 IL- IL-17F IL-1 6 6 IL-3R Relative mrn expression 3 1 5 3 1 RORγt IL-6+TGFβ IL-6+TGF β + 8r cmp 6 5 3 1 RORα IL-6+TGFβ IL-6+TGF β + 8r cmp 8 6 hr IL-6+TGFβ IL-6+TGF β + 8r cmp 15 1 5 IL-6+TGFβ IL-6+TGF β + 8r cmp 8 IL- IL-17F IL-1 5 6 IL-3R Relative mrn expression 6. 1.5 1. RORγt 15 1 5 3 RORα. 1.5 1. hr 3 1 + 8 r cmp.5. + 8 r cmp 1 + 8 r cmp.5. + 8 r cmp Supplementary Figure 6: Transcriptional regulation of Th17 differentiation in Gnas CD CD T cells FCS-sorted naive CD T cells were cultured for days under two Th17 differentiation conditions; IL-6/TGFβ () or IL-6/IL-3/IL-1β (). The CD T cells were stimulated by anti-cd3/8 bs for h. The mrn levels of cytokines and transcriptional factors were determined by qpcr. The expression levels were normalized to the expression of Rplp housekeeping gene. Data are presented as mean ± s.e.m of duplicates from one of two similar experiments.
Supplementary Figure 7. 3 RORγt Relative mrn expression 5 3 1 RORγt 16 3 8 6 8 hours after differentiation Relative mrn expression 1 6 IL-17 IL-6+TGFβ IL-6+TGF β + 8r-cMP Supplementary Figure 7: The RORγt mrn expression during Th17 differentiation in Gnas CD CD T cells () The RORγt mrn expression in and Gnas CD CD cells during Th17 differentiation. The sorted naïve CD T cells were treated by Th17 condition (IL-6 and TGFβ, anti CD3/8 bs and neutralized bs for IL- and IFNγ) for indicated the times (16,, 8, 7h after differentiation). () The mrn expression of RORγt and IL-17 at 8h after Th17 differentiation. The sorted naïve CD T cells were differentiated by Th17 condition (IL-6 and TGFβ) with or without 8r-cMP (5 µm) for 8h. The mrn expression was normalized to the housekeeping gene Rplp. The mrn expressions are shown as mean ± s.e.m of duplicated samples.
Supplemental Figure 8. Untreated IL-6+ TGFβ 5 min 15 min 3 min 6 min.7% 3.6 %. % 1.9 %.7 % Cell count 81 536 896 75 388. % 5.6 % % 6. %. % 36 89 1 68 366 pstat3 PE IL-6+ TGFβ % of Max % of Max pstat3 PE pstat3 PE Supplemental Figure 8: Stat3 phosphorylation in Gnas CD CD T cells () ctivation of Stat3 in and Gnas CD CD T cells. Enriched naive CD T cells were cultured in IMDM medium for indicated periods after treatment of IL-6 ( ng/nl)/ TGFβ ( ng/ml) and the levels of p-stat3 (py75) were determined (FCS). The numbers in the bottom of the histogram are the mean fluorescence intensity. The numbers displayed above the gate represents the percentage of positively stained cells. () CD T cells from and Gnas CD mice were stimulated by anti-cd3 (1 µg/ml) and CD8 (1 µg/ml) bs with the indicated cytokines (IL-6, ng/ml; IL-3,1 ng/ml; IL-1β, 1 ng/ml and TGFβ, ng/ml) for 15 min, and p-stat3 (py75) levels were determined (FCS). The data shown are representative of one out of two independent experiments.
Supplemental Figure 9. fmol cmp /million cells 3 5 15 1 5 control αcd3 αcd3+cd8 control αcd3 αcd3+cd8 control Forskolin +Rolipram Supplemental Figure 9: TCR cross-linking enhances intracellular cmp production Splenic CD T cells were stained with anti-cd3 b (5 µg/ml), placed on ice for 1h, and then incubated with rolipram (1 µm) for 5 min at 37 C. Cells were further treated with forskolin (1 µm) and a combination of goat anti-hamster b (1 µg/ml) with or without anti-cd8 b (1 µg/ml) as indicated, for 1 min. Cyclic MP levels were determined (RI). The data are presented as mean ± s.e.m of duplicate samples.
Supplemental Figure 1. Relative expression 1 1 8 6 Orai 1 Orai Orai 3 Stim1 Stim Relative expression 5 35 3 5 15 1 5 CaV1. CaV1.3 CaV beta1 Supplemental Figure 1: Expression levels of ORI, STIM and L-type Ca + channels subunits in and Gnas CD CD T cells Total RN was extracted from splenic CD T cells sorted from and Gnas CD mice. The mrn expression levels for ORI, STIM and L-type Ca+ channels were normalized to the expression of the Rplp housekeeping gene. Data are presented as mean ± s.e.m from mice.
Supplemental Figure 11. IL-6+IL-3+IL-1! efore transfer IL-6+IL-3+IL-1!+8r-cMP 11 % of original W +8r-cMP IFNγ 1 9 8 6 IL-17 p<.1 7 5 1 15 5 3 Days after transfer C.5 IFNγ D fter transfer 3.68 +8r-cMP 1.8 1.6 56.7 17.1 35. 3.55..3 8.67 6.9 Donor cells:. 61. 5.3 Rag1 -/- Colon Rag1 -/MLN Rag1 -/Spleen +8r-cMP 1. IL-17 Supplemental Figure 11: Cyclic MP enhances the colitogenicity of in vitro differentiated Th17 cells (IL-6/IL-3/IL-1β) in an adoptive transfer model of colitis. FCS-sorted naive CD T cells from or GnasΔCD spleens were cultured for days under Th17 differentiation condition (IL-6/IL-3/IL-1β with/without 8r-cMP, 5 µm). The differentiated Th17 cells (1 15 cells per mouse) were adoptively transferred into Rag1-/- mice. () The intracellular expression of IFNγ and IL-17 in Th17 cells before transfer. () Percentage of initial body weight of Rag1-/- recipients transferred with Th17 cells. Data shown are mean ± s.e.m, n=5 in each group. The p value indicates two away NOV of the difference between recipients receiving either Th17 or 8r-cMP-treated Th17 cells. (C) Intracellular expression of IFNγ and IL-17 in Th17 cells 8 days post-transfer. CD+ cells harvested from the spleens or MLN of recipient mice were stimulated with PM/ionomycin for h. Intracellular cytokine levels were determined by flow cytometry. (D) Histological analysis in the colons of recipients receiving in vitro differentiated Th17 cells with or without 8r-cMP (original magnification, 5, scale bar: 1µM).
Supplementary Table 1: Primers sequence: Gene Forward primer (5-3 ) Reverse primers (5-3 ) Rplp GTGCGCGTCCGCT GTTCTTGCCCTCGCCC Gnas GCGGGCGCGGTCT CCCTCTCCGTTCCCTT hr CCGTCCTCCTGGTTCGCC CCTTCTTCTCCGTTGCGGTCTC Rorc CGCCCTGTGGGCT GGGGGCGGCTTGG Rora TGTGTCGCGCGTGG CGTTCTTCTGCGGGCGG Foxp3 TCGTCCCTTGCGCC CTGCGGTCCTGG Tbx1 GCCGCCCGGGC TGTGCCCCTTCCCCT Gata3 CTGTCTCCCTGGCCCTCT GGCTCTTCGCCCTTGGG Il17a GTGTTTCCTCTCC GCCGCCCCGCTTC IL CTGCGGGGTGGTCCTT CGCGCGCTTTCTCG IL1 TCGCCTCCTGTTGCTTCGTC GGGTTTGTGGCTTGGTTTGGC Il3r GCCGGCCTTCCCG TCGTGCTCTCTTCTTCGGGC Il17f TGCCTGCCCCTTCTGGGT GCGTCCTGGTCCTTCGG Stim1 GCTCTCTGCCTGCCTTCCT TCTGGCCTGGTTCCGCCT Stim GCGTGTTTTGCCGCTCTCGT GGGCCTTGCCGCG GT Cacna1c GGCCCGGTGTCGG GCGTCTCGGCTTCTTCCTC Cacna1d CCCTCGGGGTCCTCCT GCTCGTCTTGGCTGCTTTG Cacnb1 CGCCTGTGCCGTGTC GCCGGCTTCGTTGTTTG Orai1 CCGCTCGCTTCCGC GCCTGCGTGGCCC Orai TCCTCGCCCCGG CGCCCTCTGTTCTGC Orai3 GGTCCTGGGTTTGGG TTGGGCGTTGTGCGC 18s GTCCCGTTGCCCCTT CCTCCTCGGTGTGCG 6