High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma

Similar documents
Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Analysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

Long non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer

95% CI: , P=0.037).

High expression of long non-coding RNA LOC correlates with distant metastasis and exhibits a poor prognosis in patients with osteosarcoma

Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression

Increased long noncoding RNA LINP1 expression and its prognostic significance in human breast cancer

Association between downexpression of mir-1301 and poor prognosis in patients with glioma

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Long non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Long non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer

Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma

Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma

MicroRNA-1908 is a biomarker for poor prognosis in human osteosarcoma

Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer

Original Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Clinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas

IJBM. Long non-coding RNA PVT1 as a novel potential biomarker for predicting the prognosis of colorectal cancer

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Research Article Expression and Clinical Significance of the Novel Long Noncoding RNA ZNF674-AS1 in Human Hepatocellular Carcinoma

Reduced expression of mir-564 is associated with worse prognosis in patients with osteosarcoma

Overexpression of LncRNA FER1L4 in endometrial carcinoma is associated with favorable survival outcome

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Original Article Higher expression of ZFAS1 is associated with poor prognosis in malignant melanoma and promotes cell proliferation and invasion

Upregulation of LncRNA PANDAR predicts poor prognosis and promotes cell proliferation in cervical cancer

Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Influence of ERCC2 gene polymorphisms on the treatment outcome of osteosarcoma

LncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Original Article Long non-coding RNA PANDAR overexpression serves as a poor prognostic biomarker in oral squamous cell carcinoma

Review Article Elevated expression of long noncoding RNA UCA1 can predict a poor prognosis: a meta-analysis

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer

Circulating microrna-137 is a potential biomarker for human glioblastoma

Down-regulation of mir p is correlated with clinical progression and unfavorable prognosis in gastric cancer

Clinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.

Increased expression of long noncoding RNA LINC00961 suppresses glioma metastasis and correlates with favorable prognosis

Increasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis

Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer. Cheol Min Kang 2018/04/05

Association of mir-21 with esophageal cancer prognosis: a meta-analysis

Department of Oral Medicine, Qilu Hospital, Institute of Stomatology, Shandong University, Jinan, Shandong, China 2

Expression levels and the prognostic value of long non-coding RNA PVT1 in serum of Han and Uygur gastric cancer patients in Xinjiang, China

Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable prognosis

Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer

Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients

Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome

Expression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological staging of the cancer

The effect of delayed adjuvant chemotherapy on relapse of triplenegative

Cancer Cell Research 19 (2018)

Original Article microrna-217 was downregulated in ovarian cancer and was associated with poor prognosis

Original Article Decreased expression of lncrna TMED11P is correlated with progression and prognosis in pancreatic ductal adenocarcinoma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

Long noncoding RNA ABHD11-AS1 predicts the prognosis of pancreatic cancer patients and serves as a promoter by activating the PI3K-AKT pathway

Review Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association with Pathological Features

Long noncoding RNA SNHG15, a potential prognostic biomarker for hepatocellular carcinoma

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Up-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma

Increased expression of long noncoding RNA AK predicts worse clinical outcome in hepatocellular carcinoma

Value of long chain non-coding rnacrnde-h and gas5 in predicting the prognosis of multiple myeloma.

Biomedical Research 2017; 28 (21): ISSN X

The diagnostic value of determination of serum GOLPH3 associated with CA125, CA19.9 in patients with ovarian cancer

Effect of variation of ABCB1 and GSTP1 on osteosarcoma survival after chemotherapy

A study on clinicopathological features and prognostic factors of patients with upper gastric cancer and middle and lower gastric cancer.

Original Article Down-regulation of tissue microrna-126 was associated with poor prognosis in patients with cutaneous melanoma

mir-125a-5p expression is associated with the age of breast cancer patients

Only Estrogen receptor positive is not enough to predict the prognosis of breast cancer

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143

Original Article MicroRNA-101 is a novel biomarker for diagnosis and prognosis in breast cancer

Original Article High expression of long non-coding RNA SPRY4-IT1 predicts poor prognosis of clear cell renal cell carcinoma

Long non-coding RNA FOXD2-AS1 functions as a tumor promoter in colorectal cancer by regulating EMT and Notch signaling pathway

Prognostic significance of nemo like kinase in nasopharyngeal carcinoma

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

Review Article Potential clinical roles of LncRNA in gastric cancer

The prognostic effect of LINC00152 for cancer: a meta-analysis

Transcription:

European Review for Medical and Pharmacological Sciences 2018; 22: 7640-7645 High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma X.-H. HU, J. DAI, H.-L. SHANG, Z.-X. ZHAO, Y.-D. HAO Department of Orthopedics, The Affiliated Huaian No. 1 People s Hospital of Nanjing Medical University, Huai an, Jiangsu, China Abstract. OBJECTIVE: Long noncoding RNA DICER1-AS1 (DICER1-AS1) has been reported to be upregulated in osteosarcoma cells and to serve as a tumor promoter. However, the clinical significance of DICER1-AS1 in osteosarcoma remains unclear. The aim of this study was to investigate the association of DICER1-AS1 expression with prognosis of osteosarcoma. PATIENTS AND METHODS: The expression of DICER1-AS1 was measured in 214 osteosarcoma samples and normal bone samples by using Real-time PCR. The correlations between DI- CER1-AS1 expression and clinical features were statistically analyzed. Overall survival (OS) and disease-free survival (DFS) were examined using Kaplan-Meier curves. Multivariate analyses were performed to analyze the prognostic significance of DICER1-AS1 expression. RESULTS: It was found that the expression levels of DICER1-AS1 in osteosarcoma tissues were significantly higher than those in corresponding noncancerous bone tissues (p < 0.01). Higher DICER1-AS1 had significant association with clinical stage (p = 0.005) and distant metastasis (p = 0.000). Kaplan-Meier survival analysis showed that patients with high DICER1-AS1 expression had a shorter OS and DFS compared with the low DICER1-AS1 expression group (p = 0.007 and p < 0.0001). In a multivariate Cox model, our results showed that DICER1-AS1 expression was an independent poor prognostic factor for both 5-year OS (HR = 3.236, 95% CI: 1.148-5.347; p = 0.004) and 5-year DFS (HR = 3.935, 95% CI: 1.556-6.349; p = 0.001). CONCLUSIO: DICER1-AS1 is up-regulated in osteosarcoma and may serve as a potential prognostic biomarker for osteosarcoma. Key Words: LncRNA DICER1-AS1, Osteosarcoma, Prognosis. Introduction Osteosarcoma is a debilitating, high-grade primary bone malignancy affecting rapidly growing bones, and is responsible for 20% of all primary bone sarcomas 1,2. Osteosarcoma is the most frequent primary bone malignant tumor and is often identified in children between the age of 10 and 20 years 3. With the advancement of multiple therapeutic strategies for osteosarcoma including surgical resection, adjuvant chemotherapy and radiotherapy, the 5-year survival rate of osteosarcoma patients has been dramatically improved 4,5. However, the prognosis of osteosarcoma patients with metastases is rather poor, and the long-term survival rate is only 10-30% 6. Therefore, examining the pathogenesis and biological features of osteosarcoma is crucial to enhance early detection and treatment. In the human genome, approximately 2% of transcripts can be translated into proteins, whereas 98% of transcripts are noncoding RNAs (ncrnas) 7. Long noncoding RNA (lncrna), >200 nucleotides in length, is a member of the non-coding RNA family that can regulate gene expression in transcriptional or posttranscriptional level 8. Growing studies 9-11 show that lncrnas could control various cellular processes, including proliferation, differentiation, apoptosis and metastasis, and are implicated in human diseases. More importantly, emerging evidence indicates that lncrnas may play complex and extensive roles in promoting the tumorigenesis and progression of tumors 12,13. In addition, aberrantly expressed lncrnas can be detected in tumor tissues, and their expression profiles are different in different types of tumor. These findings indicate lncrnas as suitable biomarkers to be used for osteosarcoma diagnosis and prognosis 14,15. Recently, lncrna DICER1-AS1 (DICER1-AS1), a novel tumor-related lncrna, was reported to be abnormally expressed in osteosarcoma cells by lncrna microarray and RT-PCR. Further cells experiments showed that 7640 Corresponding Author: Yue-dong Hao, MD; e-mail: hyd197500@yeah.net

LncRNA DICER1-AS1 and osteosarcoma DICER1-AS1 may function as a tumor promoter in osteosarcoma progression 16. Up to date, this is the only study on the expression and biological function of DICER1-AS1 in tumor. However, whether DICER1-AS1 expression was dysregulated in osteosarcoma tissues and its clinical significance in osteosarcoma patients, remain largely unknown. Our present aimed to detect DICER1-AS1 expression in osteosarcoma patients and its potential as a prognostic biomarker for osteosarcoma patients. Patients and Methods Patients A total of 214 clinical samples were obtained from patients with osteosarcoma and paired adjacent nontumor bone tissue at The Affiliated Huaian No.1 People s Hospital of Nanjing Medical University. All specimens were snap frozen in liquid nitrogen immediately after surgery and stored at -80 C. None of the patients had previously received radiotherapy, chemotherapy, or immunotherapy. The stage of the disease was classified according to the pathological Tumor-Node-Metastasis staging system. The follow-up information of all the participants was updated every 3 months for 5 years. This study was approved by the Research Ethics Committee of The Affiliated Huaian No.1 People s Hospital of Nanjing Medical University. Written informed consent was obtained from all of the patients. RNA Extraction and RT-PCR Total RNA was extracted with the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer s instructions. cdna was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). Quantitative reverse transcription polymerase chain reaction (qrt-pcr) was conducted using a SYBR Premix Ex Taq II Kit (Thermo Fisher Scientific, Waltham, MA, USA) on an Applied Biosystems 7500 Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The relative levels of DICER1-AS1 were normalized to the expression of U6 by the 2 -ΔΔCt method. The primers used in this study were synthesized by GenePharma Company (Xuhui, Shanghai, China) and the sequences were shown in Table I. Statistical Analysis All data were analyzed SPSS 17.0 using the software package (SPSS Inc., Chicago, IL, USA). Data were analyzed using independent two-tailed t-test. The paired-samples t-test was used in the analysis of differential DICER1-AS1 expression between tumor and normal tissues. Associations between clinicopathological parameters and DI- CER1-AS1 expression were evaluated using chisquare tests. The overall survival (OS) and disease-free survival (DFS) were estimated using the Kaplan-Meier method. The significance of survival variables was evaluated using a multivariate Cox proportional hazards regression analysis. A p-value < 0.05 is considered statistically significant. Results Increased Expression of DICER1-AS1 in Human Osteosarcoma Tissues To reveal the role of DICER1-AS1 in progression of osteosarcoma, we performed the qrt- PCR to evaluate the expression of DICER1-AS1 in 214 osteosarcoma and corresponding non-tumor tissues. We found that relative expression of DICER1-AS1 normalized to U6 in renal cancer was found to be 3.89 ± 0.47, while that in matching adjacent normal specimens was 7.67 ± 0.93. Statistical results indicated that DICER1-AS1 expression was upregulated in osteosarcoma tissues compared with normal tissues (p < 0.01, Figure 1). Correlation of DICER1-AS1 Expression with Clinicopathological Features To investigate the relationship between DI- CER1-AS1 expression and clinical features in osteosarcoma, all osteosarcoma patients were classified into two groups depending on DICER1-AS1 levels in tumor tissues relative to the median Table I. Primer sets used in the present study. Gene names Forward (5-3 ) Reverse (5-3 ) Application DICER1-AS1 TGACCAGTCTTACCCCTCCT CTGAAGCACCTGAAATGCG Real-time RT-PCR U6 ACCCTGAGAAATACCCTCACAT GACGACTGAGCCCCTGATG Real-time RT-PCR 7641

X.-H. Hu, J. Dai, H.-L. Shang, Z.-X. Zhao, Y.-D. Hao Figure 1. Expression of DICER1-AS1 in osteosarcoma tissues and matched normal bone tissues. DICER1-AS1 expression was significantly higher in osteosarcoma tissues than in the matched normal bone tissues (p < 0.01). ratio: high DICER1-AS1 expression group (n = 110) and low DICER1-AS1 expression group (n = 104). As shown in Table II, it was observed that DICER1-AS1 expression was closely associated with clinical stage (p = 0.005) and distant metastasis (p = 0.000). However, there were no relationships between DICER1-AS1 expression and other clinicopathological parameters, including age, gender, tumor size, anatomic location and response to chemotherapy (all p > 0.05). Association of DICER1-AS1 Expression with Prognosis of Osteosarcoma Patients In order to further explore the prognostic value of DICER1-AS1 expression in osteosarcoma, survival curves were constructed by Kaplan-Meier method and compared by the log-rank test. As shown in Figure 2, osteosarcoma patients with higher DICER1-AS1 expression level had shorter OS than those with high DICER1-AS1 expression level (p = 0.007). Similarly, we also found that DICER1-AS1 expression was significantly correlated with osteosarcoma patients DFS (p < 0.0001, Figure 3). In the multivariate analysis using the Cox proportional hazards model, we further found that DICER1-AS1 expression (p = 0.004 and 0.001, respectively), clinical stage (p = 0.015 and 0.004, respectively) and distant metastasis (p = 0.006 and 0.001, respectively) were independent prognostic factors for both OS and DFS in osteosarcoma patients (Table III). Discussion Despite the advances in therapeutic strategies, outcome remains poor for most osteosarcoma patients with metastatic or recurrent osteosarcoma; therefore, understanding the mechanisms underlying osteosarcoma pathogenesis may help yield novel biomarkers for early detection, prog- Table II. Association of DICER1-AS1 expression with clinicopathologic features of osteosarcoma. DICER1-AS1 expression No. of Clinicopathologic features cases High Low p-value Age (y) 0.565 < 25 100 48 52 25 114 62 52 Gender Male 136 70 66 Female 78 40 38 Tumor size (cm) > 8 106 60 46 8 108 50 58 Anatomic location Tibia/femur 135 65 70 Elsewhere 79 45 34 Response to chemotherapy Good 116 55 61 Poor 98 55 43 Clinical stage 0.005 IIA 134 59 75 IIB/III 80 51 29 Distant metastasis 0.000 Absent 145 64 81 Present 69 46 23 7642

LncRNA DICER1-AS1 and osteosarcoma Figure 2. Kaplan-Meier postoperative survival curve for patterns of patients with osteosarcoma. Osteosarcoma patients with high DICER1-AS1 expression showed shorter overall survival time than those with low DICER1-AS1 expression (p = 0.0007). Figure 3. Kaplan-Meier postoperative survival curve for patterns of patients with osteosarcoma. Osteosarcoma patients with high DICER1-AS1 expression showed shorter disease-free survival time than those with low DICER1-AS1 expression (p < 0.0001). nosis and treatment 17,18. Numerous studies 19-21 have demonstrated that several lncrnas, such as lncrna TP73-AS1, lncrna ZFAS1, lncrna XIST, may serve as a diagnostic and prognostic marker in various tumors, including osteosarcoma. In the present study, our data indicated that DICER1-AS1 was important for osteosarcoma initiation and progression and held promise as a prognostic biomarker to predict survival in osteosarcoma. Emerging studies have confirmed that lncrnas are involved in cell proliferation, apoptosis, invasion and metastasis in various types of cancers, including osteosarcoma 22. For instance, Zhang et al 23 reported that lncrna FOXC2-AS1 was highly expressed in osteosarcoma tissues and cell lines and associated with poor prognosis of osteosarcoma patients, and its forced expression promoted doxorubicin resistance in osteosarcoma by modulating FOXC2 expression. Cui et al 24 found that the expression of lncrna HOXA11- AS was significantly up-regulated in osteosarcoma patients and associated with advanced clinical stage, distant metastasis and poor overall survival of osteosarcoma. Further gain- and lost-of-function assay showed that HOXA11-AS served as a tumor promoter by sponging mir-124-3p in osteosarcoma. Wen et al 25 reported that lncrna UCA1 have the potential to be a promising biomarker for discriminating patients with osteosarcoma from healthy controls and predicting the prognosis of osteosarcoma patients. Recently, Gu et al 16 firstly reported DICER1-AS1 as a up-regulated lncrna in osteosarcoma cells. Then, they performed in vivo and in vitro assay, finding that knockdown of DICER1-AS1 significantly suppressed the proliferation, invasion and autophagy of osteosarcoma cells via mir-30b/atg5. However, whether DICER1-AS1 was up-regulated in clinical osteosarcoma tissues, and its prognostic value have not been investigated. In this study, based on the results of DICER1-AS1 expression in osteosarcoma cells, we firstly performed Table III. Multivariate survival analysis of overall survival and disease-free survival in 214 osteosarcoma patients. Overall survival Disease-free survival Variables RR 95% CI p RR 95% CI p Age 1.562 0.782-2.233 0.415 1.493 0.944-2.039 0.327 Gender 1.836 0.559-2.672 0.232 1.553 0.739-2.328 2.118 Tumor size 2.214 0.932-2.873 0.118 1.884 0.582-2.449 0.217 Anatomic location 1.664 0.873-2.326 0.177 1.885 0.942-2.683 0.114 Response to chemotherapy 1.347 0.739-2.215 0.114 1.573 0.949-2.443 0.134 Clinical stage 3.149 1.033-4.237 0.015 3.673 1.235-5.623 0.004 Distant metastasis 3.136 1.235-5.028 0.006 4.237 1.663-6.238 0.001 DICER1-AS1 expression 3.236 1.148-5.347 0.004 3.935 1.556-6.349 0.001 7643

X.-H. Hu, J. Dai, H.-L. Shang, Z.-X. Zhao, Y.-D. Hao RT-PCR to detect the levels of DICER1-AS1 in osteosarcoma patients. Consistent with previous study, our results also confirmed DICER1-AS1 as an up-regulated lncrna in osteosarcoma patients. Subsequently, clinical assay revealed that DICER1-AS1 expression was closely associated with clinical stage and distant metastasis, indicating that DICER1-AS1 may contribute to malignant tumor. Moreover, based on Kaplan-Meier survival analysis, we demonstrated that higher DICER1-AS1 expression was associated with poorer DFS and OS, when compared to lower DI- CER1-AS1 expression. Most importantly, multivariate analysis revealed that DICER1-AS1 could be used as an independent prognostic factor for both OS and DFS in osteosarcoma patients. Our finding, for the first time, indicated the possibility of using high expression levels of ICER1-AS1 as a predictor for prognosis and survival. However, to be honest, one limitation of the current study is that there was relatively small sample size enrolled. Thus, larger sample size will be needed to further demonstrate our findings. Conclusions We suggest that high levels of DICER1-AS1 might reflect a less aggressive osteosarcoma phenotype and predict better survival in patients with osteosarcoma. DICER1-AS1expression may be a useful prognostic marker for this disease. Conflict of Interest The Authors declare that they have no conflict of interests. References 1) Ottaviani G, Jaffe N. The epidemiology of osteosarcoma. Cancer Treat Res 2009; 152: 3-13. 2) Broadhead ML, Clark JC, Myers DE, Dass CR, Choong PF. The molecular pathogenesis of osteosarcoma: a review. Sarcoma 2011; 2011: 959248. 3) Mirabello L, Troisi RJ, Savage SA. Osteosarcoma incidence and survival rates from 1973 to 2004: data from the surveillance, epidemiology, and end results program. Cancer 2009; 115: 1531-1543. 4) Gill J, Ahluwalia MK, Geller D, Gorlick R. New targets and approaches in osteosarcoma. Pharmacol Ther 2013; 137: 89-99. 5) Botter SM, Neri D, Fuchs B. Recent advances in osteosarcoma. Curr Opin Pharmacol 2014; 16: 15-23. 6) Anderson ME. Update on survival in osteosarcoma. Orthop Clin North Am 2016; 47: 283-292. 7) Kentwell J, Gundara JS, Sidhu SB. Noncoding RNAs in endocrine malignancy. Oncologist 2014; 19: 483-491. 8) Spizzo R, Almeida MI, Colombatti A, Calin GA. Long noncoding RNAs and cancer: a new frontier of translational research? Oncogene 2012; 31: 4577-4587. 9) Nagano T, Fraser P. No-nonsense functions for long noncoding RNAs. Cell 2011; 145: 178-181. 10) Uchida S, Dimmeler S. Long noncoding RNAs in cardiovascular diseases. Circ Res 2015; 116: 737-750. 11) Batista PJ, Chang HY. Long noncoding RNAs: cellular address codes in development and disease. Cell 2013; 152: 1298-1307. 12) Cheetham SW, Gruhl F, Mattick JS, Dinger ME. Long noncoding RNAs and the genetics of cancer. Br J Cancer 2013; 108: 2419-2425. 13) Zhang M, Wu WB, Wang ZW, Wang XH. LncRNA NEAT1 is closely related with progression of breast cancer via promoting proliferation and EMT. Eur Rev Med Pharmacol Sci 2017; 21: 1020-1026. 14) Li W, Li N, Kang X, Shi K. Circulating long non-coding RNA AFAP1-AS1 is a potential diagnostic biomarker for non-small cell lung cancer. Clin Chim Acta 2017; 475: 152-156. 15) Li JP, Liu LH, Li J, Chen Y, Jiang XW, Ouyang YR, Liu YQ, Zhong H, Li H, Xiao T. Microarray expression profile of long noncoding RNAs in human osteosarcoma. Biochem Biophys Res Commun 2013; 433: 200-206. 16) Gu Z, Hou Z, Zheng L, Wang X, Wu L, Zhang C. LncRNA DICER1-AS1 promotes the proliferation, invasion and autophagy of osteosarcoma cells via mir-30b/atg5. Biomed Pharmacother 2018; 104: 110-118. 17) Ferrari S, Serra M. An update on chemotherapy for osteosarcoma. Expert Opin Pharmacother 2015; 16: 2727-2736. 18) Ren L, Khanna C. Role of ezrin in osteosarcoma metastasis. Adv Exp Med Biol 2014; 804: 181-201. 19) Zhang L, Fang F, He X. Long noncoding RNA TP73-AS1 promotes non-small cell lung cancer progression by competitively sponging mir- 449a/EZH2. Biomed Pharmacother 2018; 104: 705-711. 20) Nie F, Yu X, Huang M, Wang Y, Xie M, Ma H, Wang Z, De W, Sun M. Long noncoding RNA ZFAS1 promotes gastric cancer cells proliferation by epigenetically repressing KLF2 and NKD2 expression. Oncotarget 2017; 8: 38227-38238. 21) Li GL, Wu YX, Li YM, Li J. High expression of long non-coding RNA XIST in osteosarcoma is associated with cell proliferation and poor prognosis. Eur Rev Med Pharmacol Sci 2017; 21: 2829-2834. 7644

LncRNA DICER1-AS1 and osteosarcoma 22) Fatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet 2014; 15: 7-21. 23) Zhang CL, Zhu KP, Ma XL. Antisense lncrna FOXC2-AS1 promotes doxorubicin resistance in osteosarcoma by increasing the expression of FOXC2. Cancer Lett 2017; 396: 66-75. 24) Cui M, Wang J, Li Q, Zhang J, Jia J, Zhan X. Long non-coding RNA HOXA11-AS functions as a competing endogenous RNA to regulate ROCK1 expression by sponging mir-124-3p in osteosarcoma. Biomed Pharmacother 2017; 92: 437-444. 25) Wen JJ, Ma YD, Yang GS, Wang GM. Analysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma. Eur Rev Med Pharmacol Sci 2017; 21: 498-503. 7645