Correlation between Vitamin D Receptor SNP ApaI and liver fibrosis in HCV patients from Thrace A. Beka 1, T. Mylopoulou 2, V. Papadopoulos 2, I. Karakasiliotis 2, P. Mavromara 1, K. Mimidis 2, S. Veletza 2 1 DEPARTMENT OF MOLECULAR BIOLOGY AND GENETICS, DEMOCRITUS UNIVERSITY OF THRACE, ALEXANDROUPOLIS, GREECE 2 DEPARTMENT OF MEDICINE, DEMOCRITUS UNIVERSITY OF THRACE, ALEXANDROUPOLIS, GREECE
HCV infection is a major public health problem 71 million with chronic HCV infection worldwide (1% of the population.) 1.75 million new infections in 2015 ~399.000 deceased yearly 15-45% spontaneous clearance There is no vaccine available Global Hepatitis Report 2017. Geneva: World Health Organization; 2017. Licence: CC BY- NC-SA 3.0 IGO
Pathogenesis of HCV infection Normal Chronic Liver Liver Hepatocellular Liver Infection Steatosis Cirrhosis Carcinoma Ke and Chen (2012) Hepatitis C Virus and Cellular Stress Response: Implications to Molecular Pathogenesis of Liver Diseases. Viruses (doi: 10.3390/v4102251), edited
Hepatitis C virus Member of the Flaviviridae family - Hepacivirus genus Positive-sense single stranded RNA Blausen Medical Communications Abdel-Hakeem MS and Shoukry NH (2014) Protective immunity against hepatitis C: many shades of gray. Front. Immunol. 5:274. doi: 10.3389/fimmu.2014.00274
HCV has an increased genetic heterogeneity 1 6 5 4 HCV genotype influences the outcome of PEG- IFN/RBV therapy and viral pathogenicity. 7 3 2 Smith, D. B., Bukh, J., Kuiken, C., Muerhoff, A. S., Rice, C. M., Stapleton, J. T. and Simmonds, P. (2014), Expanded classification of hepatitis C virus into 7 genotypes and 67 subtypes: Updated criteria and genotype assignment web resource. Hepatology, 59: 318 327. doi:10.1002/hep.26744
The role of host genetic heterogeneity in HCV infection IFNL3 C/C IFNL4 T/T HCV-1,2,3 and 4Higher RVR rates MTTP TT or TG HCV-3 Higher levels of liver steatosis VDR bat haplotype CCA and ApaI CC HCV-1/2/3 Swiss patients Rapid fibrosis Riva et al, review, Clinical Microbiology and Infection, 2014, Zampino et al, Journal of Viral Hepatitis, 2008, Baur et al, Liver International, 2012
Why VDR? Low 25(OH) D levels are correlated to advanced fibrosis. VDR polymorphisms have been associated with rapid fibrosis progression in HCV patients from Switzerland and Brazil Petta et al, 2010, Baur et al, 2012, Paula Scalioni et al 2018, Gascon-Barre et al, 2003
Aim To investigate the possible association of VDR ApaI (rs7975232) genotype of HCV monoinfected patients from Thrace-Greece with the stage of liver fibrosis.
Experimental design HCV RNA positive FibroScan Collecting blood samples DNA isolation PCR ApaI Digestion Gel Electrophoresis Patient characteristics n = 67 Gender (Male/Female) 46/21 Age Average 52 (22-78) Ethnicity Caucasian (100%) HCV genotype 1 36 HCV genotype 3 22 HCV non1-non3-genotype 9 FibroScan 0-1 25 FibroScan 2 10 FibroScan 3 8 FibroScan 4 / Cirrhotic 24 FibroScan Interpretation F0-1 2-6.9 kpa F2 7-9 kpa F3 10-14 kpa F4 14-75 kpa
Experimental design HCV RNA positive FibroScan Collecting blood samples DNA isolation PCR ApaI Digestion Gel Electrophoresis Credit: Genome Decoration Page /NCBI CAGAGCATGGACAGGGAGCAAGGCCAGGCAGGGACAGGGCCAGGTGCGCCCATGGAAGGACCTAGGTC TGGATCCTAAATGCACGGAGAAGTCACTGGAGGGCTTTGGGGCCAGGCAGTGGTATCACCGGTCAGCAGTCATAGA GGGGTGGCCTAGGGGGTGCTGCCGTTGAGTGTCTGTGTGGGTGGGGGGTGGTGGGATTGAGCAGTGAGGGGC CCAGCTGAGAGCTCCTGTGCCTTCTTCTCTATCCCCGTGCCCACAGATCGTCCTGGGGTGCAGGACGCCGCGCTGAT CGAGGCCATCCAGGACCGCCTGTCCAACACACTGCAGACGTACATCCGCTGCCGCCACCCGCCCCCGGGCAGCCAC CTGCTCTATGCCAAGATGATCCAGAAGCTAGCCGACCTGCGCAGCCTCAATGAGGAGCACTCCAAGCAGTACCGCTG CCTCTCCTTCCAGCCTGAGTGCAGCATGAAGCTAACGCCCCTTGTGCTCGAAGTGTTTGGCAATGAGATCTCCTGACT AGGACAGCCTGTGGCGGTGCCTGGGTGGGGCTGCTCCTCCAGGGCCACGTGCCAGGCCCGGGGCTGGCGGCTAC TCAGCAGCCCTCCTCACCCCGTCTGGGGTTCAGCCCCTCCTCTGCCACCTCCCCTATCCACCCAGCCCATTCTCTCTCC TGTCCAACCTAACCCCTT ApaI SNP
Results Ld 1 2 3 4 5 6 7 8 9 10 11 12 N PCR product 695bp Ld 1 2 3 4 5 6 7 8 Ld ApaI Digestion Possible Outcomes: T 695bp G 482bp 213bp
Results 100% 90% VDR ApaI genotype GG is linked to low fibrosis 80% 70% 60% 50% 40% 30% 20% high fibrosis (n=32) low fibrosis (n=35) 10% 0% TT GG TG P = 0.032
Results 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% F4 (n=24) F0-1 (n=25) VDR ApaI TT and TG genotypes that are linked to advanced fibrosis and cirrhosis 0% TT GG TG P=0.006 P=0.016 P=0.006
Conclusion VDR ApaI genotype GG is linked to low fibrosis progression, in contrast to the TT and TG genotypes that are linked to advanced fibrosis and cirrhosis.
Acknowledgements Biochemistry and Molecular Virology Molecular Biology and Genetics P. Mavromara K. Katsani M. Cheilas E. Filippopoulou Medical Biology Department of Medicine S. Veletza I. Karakasiliotis E. Gatzidou T. Georgoudis Internal Medicine General University Hospital K. Mimidis T. Mylopoulou
Thank you for your attention!!!