Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania

Romanian Biotechnological Letters Vol. 18, No. 6, 2013 Copyright 2013 University of Bucharest Printed in Romania. All rights reserved ORIGINAL PAPER Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania Abstract Received for publication, June 5, 2013 Accepted, August 2, 2013 C. P. CORNEA 1, F. ISRAEL-ROMING 1,*, M. CIUCA 2, C. VOAIDES 1 1 Department of Biotechnologies, University of Agronomical Sciences and Veterinary Medicine / Centre for Applied Biochemistry and Biotechnology BIOTEHNOL, 59 Marasti Blvd., 011464 Bucharest, Romania 2 Department of Plant Breeding and Seed Multiplication, National Agricultural Research and Development Institute NARDI Fundulea, 1st Nicolae Titulescu Street, 915200 Fundulea, Calarasi County, Romania *Corresponding author: florentina.israel@biotehnologii.usamv.ro; florentinarom@yahoo.com Molecular identification of 85 fungal isolates from Romanian wheat cultivars collected between 2007 and 2008 was performed by PCR assays using specific primer pairs for F. graminearum, F. culmorum and F. sporotrichoides. Chemotype determination was achieved with primers for four genes involved in trichothecene biosynthesis (tri3, tri7, tri12 and tri13). The pathogenity of 19 Fusarium isolates against two wheat cultivars was tested and deoxynivalenol content was achieved by HPLC-RP assays. PCR analysis revealed that F. graminearum was the most prevalent species, representing 83.5%. The amplicon produced by primer set tox5-1/tox5-2 was present in 88.23% of the tested Fusarium isolates, indicating their thricothecene biosynthesis potential. Molecular analysis proved no nivalenol producers in the tested isolates, shown that all F. culmorum isolates were 3- acetyldeoxynivalenol chemotype and all F. graminearum isolates were 15- acetyldeoxynivalenol chemotype. Pathogenity test resulted in germination inhibition, reduction of seedling length and necrosis. Infected seeds showed deoxynivalenol level almost three times higher for F. culmorum isolates than for F. graminearum isolates. This is the first report of molecular identification of Fusarium isolates and corresponding trichothecene chemotypes in Romanian pathogen population, proving the highest prevalence of F. graminearum, but also the presence of F. culmorum with higher aggressiveness on tested wheat cultivars. Keywords: Fusarium graminearum, F.culmorum, trichothecenes, PCR analysis, HPLC analysis Introduction Fusarium graminearum (teleomorph Gibberella zeae (Schwein.) Petch. and F.culmorum (W.C.Smith) Sacc. are the most important head-blighting pathogens of cereals in many regions of the world. In wheat, the fungal infection causes the reduction of yield and quality of harvested grains, which are often contaminated with specific mycotoxins. Fusarium infection can occur in the field and during storage, being associated with accumulation of trichothecenes, the most spread mycotoxins that are potent inhibitors of protein biosynthesis in eukaryotes and have toxic effects on human or animals (J.H. Wang & al. [24]). Among the trichothecenes produced by Fusarium species, type B (8-ketotrichothecenes) are the principal toxins synthesized by F.graminearum, and they could contribute to the virulence of fungal strains during the infection of wheat (M. Ittu & al. [5]). Based on chemical structures and position of acetyl groups, in type B trichothecenes - producing F.graminearum strains have been identified three chemotypes: deoxynivalenol (DON) and 3-acetyldeoxynivalenol (3- AcDON); deoxynivalenol (DON) and 15-acetyldeoxynivalenol (15-AcDON); nivalenol (NIV) and 4-acetylnivalenol (4-AcNIV). The mycotoxins biosynthetic pathways are partly Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8787

C. P. CORNEA, F. ISRAEL-ROMING,*, M. CIUCA, C. VOAIDES clarified, and several genes involved in their biosynthesis were identified (N.J. Alexander & al. [1]; M. Kimura & al. [28]). Different studies revealed differences in geographical distribution of chemotypes: DON chemotypes were detected mainly in North America (B. Toth & al. [21]), and both DON and NIV chemotypes in Africa, Asia and Europe (P. Jennings & al. [7]; T. Yli-Mattila and T. Gagkaeva [26]; J.B. Zhang & al. [27]). The ability to produce a certain type of mycotoxin could be established both through biochemical and molecular techniques. The biochemical approach involves the purification of mycotoxins, the methods being complicated and time consuming. The molecular techniques are based on detection of different gene clusters, by using specific primers. As target for amplification could be used primers designed from the various gene sequences: Tri13 gene (determinant for DON-NIV switching in Fusarium), Tri 7 gene (responsible for acetylating of NIV and production of 4- AcNIV) (M. Pasquali & al. [17]; J.H. Wang & al. [24]); T.G. Ward & al. [25]. Using such an approach, with single or multiplex PCR, the DON/NIV chemotypes and their acetylated forms were detected in fungal isolates from different regions all over the world, proving that PCRbased mycotoxin assays are efficient and reliable tools. Despite the important amount of information about the incidence of specific Fusarium chemotypes across Europe (B. Bakan & al. [2]; M. Pasquali & al. [16]), no data were encountered up to now about Fusarium isolates extracted from local populations of Romania. Recently, changes in DON chemotypes distribution were reported for Fusarium populations from Canada, USA, and Northern Europe (T.G. Ward & al. [25]; T. Yli-Mattila and T. Gagkaeva [26]). In this respect, the knowledge about the mycotoxins chemotypes could contribute to a better management of fungal infections and breeding of resistance, in order to obtain grains of better quality. The objectives of this research were to identify the prevalence of Fusarium species isolated from wheat in Romania and to determine their chemotypes based on biochemical and PCR methods. A comparison between the aggressiveness of some chemotype-specific fungal isolates was also performed in order to establish a possible correlation. Material and methods Strains, media, and culture conditions. The experiments were performed with 85 new Fusarium strains obtained at NARDI-Fundulea from the naturally infected grains of common wheat, durum wheat and triticale, randomly sampled between 2005 and 2009 from six locations situated in the northern part of Romania: 43 isolates (Livada Satu Mare); the South: 35 isolates (22 from Albota, two from Simnic and 11 from Fundulea), while seven isolates originated from the centre of country: three from Targu Mures and four from Brasov) (M. Ittu & al. [5]; M. Ittu & al. [6]). As reference in molecular experiments were used several F.graminearum and F.culmorum strains previously isolated at NARDI-Fundulea from wheat grains randomly sampled from Romania (Fg 96), (Fg 8713), and/or obtained from Fusarium European collections: Fc 46, Fc 58 Fg 183). Morphological identification, at genus level, was performed according to F.J. Leslie and A.B. Summerel [12]. Fungi were cultivated on Czapek Dox medium or on potato dextrose medium and stored in the Collection of NARDI-Fundulea and in the Collection of Faculty of Biotechnology from Bucharest, Romania. Molecular analysis. For molecular analysis, fungal DNA was isolated from mycelium according to Bakan & al. [2]. In order to determine the Fusarium species, four primer pairs were used (table 1). Multiplex PCR was performed using 25 μl of a reaction mixture consisting of 20ng DNA, 2.5 mm MgCl2, 50 mm KCl, 10 mm Tris HCl (ph8.3), 1,25 mm of each of the four dntps, 0,2 μm of each oligonucleotide primer, and 2U units of Taq DNA 8788 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013

Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania polymerase (Fermentas). DNA amplification was performed in an Eppendorf Mastercycler gradient using an initial 4 min denaturation at 92 0 C; and then 35 cycles of 1 min at 92 0 C, 1 min at 60 0 C, and 2 min at 72 0 C, followed by a final extension of 10 min at 72 0 C. Table 1. Primers used for Fusarium species identification Primers Sequence FC01F ATGGTGAACTCGTCGTGGC FC01R CCCTTCTTACGCCAATCTCG Fg16NF ACAGATGACAAGATTCAGGCACA Fg16NR TTCTTTGACATCTGTTCAACCCA Fg16F CTCCGGATATGTTGCGTCAA Fg16R GGTAGGTATCCGACATGGCAA Fspo1F AAAAGCCCAAATTGCTGATG Fspo1R TGGCATGTTCATTGTCACCT Fusarium species detected Amplicon size (bp) F. culmorum 570 F. graminearum 280 F. graminearum 450 F.sporotrichoides 332 Reference Nicholson & al., 1998 Nicholson & al., 1998 Demeke & al., 2005 Demeke & al., 2005 For chemotypes identification specific primers for DON, NIV and their acetylated forms has been used (table 2). PCR reactions were carried out in a volume of 25 μl, according to the indications of the authors that recommended the primers (B. Bakan & al. [2]; T. Lee & al. [11]; J.H. Wang & al. [24]; T.G. Ward & al. [25]) Table 2. Primers used for chemotype detection Primers Sequence Target Amplicon size Reference GzTri7/f1 GGCTTTACGACTCCTCAACA ATGG tri7 gene from 161bp (NIV); 172-327 bp (DON) Lee & al. GzTri7/r1 AGAGCCCTGCGAAAG(C/T)A F.graminearum CTGGTGC [11] N1-2 CTTGTTAAGCTAAGCGTTTT tri5-tri6 200 bp N1-2R AACCCCTTTCCTATGTGTTA intergenic region, F.culmorum 4056 ATCCCTCAAAAACTGCCGCT tri5-tri6 3551 ACTTTCCCACCGAGTATTTC intergenic region, F.culmorum Tri13P1 CTCSACCGCATCGAAGASTC TC Tri13P2 GAASGTCGCARGACCTTGTT TC 3NA GTGCACAGAATATACGAGC 3CON (R) TGGCAAAGACTGGTTCAC 3D15A (F) ACTGACCCAAGCTGCCATC 3D3A (F) CGCATTGGCTAACACATG 12CON (R) CATGAGCATGGTGATGTC 12NF (F) TCTCCTCGTTGTATCTGG 12-15F (F) TACAGCGGTCGCAACTTC 12-3 (F) CTTTGGCAAGCCCGTGCA tri 13 gene from F.graminearum tri 3 gene from F.graminearum tri 12 gene from F.graminearum 650 bp 859 bp (NIV) 644 bp (3-ADON) 583 bp (15-ADON) 840 bp (NIV) 610 bp (15-ADON) 243 bp (3-DON) 840 bp (NIV) 670 bp (15-ADON) 410 bp (3-ADON) Bakan & al. [2] Wang & al. [24] Ward & al. [25] Determination in vitro of fungal isolates pathogenicity. The pathogenicity of 19 Fusarium isolates, both F.culmorum and F.graminearum, against two wheat cultivars: Boema and Auradur were evaluated, according to the method described by Yli-Matila and Gakaeva [26]. Mycotoxin analysis. HPLC analysis of deoxynivalenol was performed according to the modified method of H.S. Rupp [19]. The clean-up procedures employed immunoaffinity columns instead of multifunctional MycoSep columns. The limit of detection (three times noise) was 0.02 µg/g. Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8789

Results and discussions C. P. CORNEA, F. ISRAEL-ROMING,*, M. CIUCA, C. VOAIDES 1. Identification of Fusarium isolates It is well known that the identification of fungal species by classical methods (microbiological) is a difficult mission and is based on a solid experience of the scientist. For this reason, PCR analysis with particular primers was applied, with very good results, allowing the identification of F.graminearum, F.culmorum, F.sporotrichoides, F.poae, F.equiseti, F.cerealis, F.proliferatum, F.verticillioides etc (Konietzny and Greiner [10]. Due to their importance, F.graminearum and F.culmorum were intensively studied and several primers for their identification were purposed. Results of PCR analysis with specific primers (fig.1) suggested that the dominant species in Romanian locations is F.graminearum (83.5%). F.culmorum (9.4%) was identified only in four locations, among isolates from Albota, Brasov, Livada and Simnic. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M Fig.1. Molecular identification of F.culmorum (lanes 11 and 12) and F.graminearum (lanes 1-10 and 13-14). M = 100 bp DNA ladder (Roth) Regarding the year of isolation, the older isolates (2005-2006) belonged exclusively to F.graminearum, as compared to the newest ones (2009) when F.sporotrichoides and F.culmorum dominated (42.85% and 35.71%, respectively). In 2008, 95.24% of the isolates belonged to F.graminearum, and only 4.76% were F.culmorum. The literature indicates that the local prevalence of a specific Fusarium species is influenced by climatic conditions, especially temperature (J.M. Wagacha and J.W. Muthomi [23]): F.graminearum is more frequent in the warmer, humid areas, whilst F.culmorum is predominant in north, central and west Europe as well as in Canada (T. Demeke & al. [3]). However, the climate changes encountered in Europe in the last years allowed the increase of the F.graminearum in areas previously dominated by F.culmorum (C. Waalwijk & al. [22], M. Pasquali & al. [6]). The obtained results are in concordance with these data, showing the dominance of F.graminearum in the local Fusarium populations. 1. Chemotype determination by PCR It was shown that Fusarium isolates are differentiated according to their ability to produce DON, which is considered as an aggressiveness factor for development of scab attack. For this reason, it is of outmost importance to evaluate the toxigenic potential of individual Fusarium isolates in order to predict their aggressiveness. In this study this trait was determined using the primer set tox5-1/tox5-2 which produces a unique PCR product in size of 658 bp for strains that contain tri 5 gene (M.L. Niessen and R.F. Vogel [14]). Results indicated that this amplicon was present in the most of the tested Fusarium isolates (88.23%), irrespective if they were F.graminearum or F.culmorum. 8790 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013

Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania The presence of tri5 gene in the majority of the isolates gives information about the possibility of these strains to produce trichothecene, but for chemotype determinations supplementary tests are needed. Primers for four genes (tri3, tri7, tri12 and tri13) involved in trichothecene biosynthesis were used. With primers GzTri7f1/r1 from all the isolates of F.graminearum were detected PCR products with a number of 1 to 7 repetitive 11 bp sequence, but no amplicon of 162 bp, corresponding to NIV chemotype, was obtained (fig.2). The amplification products were detected both in 15-ADON and 3-ADON producers. No correlation between the number of repeats and the origin of isolates or their agressiveness could be observed. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Fig.2. PCR amplification pattern of the tri7 region containing 11 bp repeats. M = 123 bp DNA ladder; 1-15 = different isolates of Fusarium graminearum Among the isolates tested, for 77.9% the size of amplicons varied between 194 bp and 216 bp, corresponding to three to five 11 bp repeats (34% presented the fragment of 194 bp, 27% contained four repeats, and 16.9% five repeats). The rest presented PCR products of 172 bp, 183 bp and 238 bp. For the Romanian fungal isolates the size variation of amplicons was comparable with that reported by T. Yli-Matila and T. Gagkaeva [26] but the polymorphism was more reduced than between the isolates studied by Lee & al. [11]. These data suggests a reduced molecular polymorphism among Romanian isolates regarding tri7 gene, the idea being sustained by the results obtained with RAPD analysis, using several decameric randomic primers (M. Ittu & al. [6]). The molecular analysis of the amplicons corresponding to tri3, tri12 and tri13 genes related to Fusarium chemotypes indicated that no NIV producers were present among the Romanian isolates. Regarding the DON chemotypes (15-ADON and 3-ADON), it was shown that all F.culmorum isolates from Romanian fields were 3-ADON, while F.graminearum isolates that belong to 15-ADON chemotype (fig.3). Both PCR methods applied in the experiments proved to be useful for chemotype determination and, despite the conclusions of M. Pasquali & al. [17], the primers for tri13 gene of J.H. Wang & al. [24] allowed the discrimination between 3-ADON and 15-ADON chemotypes for all Romanian isolates. No correlation between the results concerning the DON chemotype and the size of amplicons obtained with GzTri7f1/r1 primer pair was established. The results obtained for Romanian isolates are in concordance with those of K. Koncz & al. [9], L. Stepien & al. [20] and M. Pasquali & al. [16] for fungal isolates from Hungary, Poland, and Luxembourg respectively: almost all the F.graminearum isolates were chemotype 15-ADON, comparing to F.culmorum isolates which were chemotype 3-ADON. Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8791

C. P. CORNEA, F. ISRAEL-ROMING,*, M. CIUCA, C. VOAIDES M 1 2 3 4 5 6 7 8 9 Fig.3. Electrophoretic pattern of amplicons corresponding to DON chemotypes in nine Fusarium isolates. In multiplex PCR reactions were used primers recommended by J.H. Wang & al [24] (up) or by J.H. Ward & al. [25] (down). The black arrow indicates the amplicons corresponding to 15-ADON chemotype and the white one those for 3-ADON chemotype. In order to detect the level of DON produced by tri5 positive isolates, two methods were tested: PCR analysis using the primers purposed by B. Bakan & al. [2] and HPLC quantification of DON in culture medium. The amplification product (200 bp) corresponding to high level of DON biosynthesis was detected in 60% of tri5 positive fungal isolates, both F.culmorum and F.graminearum. However, the level of DON produced in experimental conditions by the majority of these isolates was reduced, suggesting that several intact, active genes are involved in DON biosynthesis, and the activation of such genes are subjected to various environmental factors, including the presence of specific inducers, oxidative stress (D.M. Gardiner & al. [4]) etc. 2. Pathogenicity/ aggressiveness of some fungal isolates and DON accumulation Based on these results, several isolates were used for in vitro and field artificial infections, in order to assess the pathogenicity/ aggressiveness and DON accumulation. Large differences among Fusarium isolates were observed: the most aggressive isolates, according to reduction of seedling length were: F1145, F1156, F1226, F1239, F1272, F1056, F1265, F1228, F1445, F1453, F1471, F1485, F1494, F1552, F1625 and F1627 (M. Ittu & al. [6]). Quantification of DON content in grains sampled from natural conditions suggested that contamination was below the European limits of DON level in unprocessed wheat [Commission Regulation (EC) no 1126/2007] even in locations where Fusarium head blight attack was more intense (M. Ittu & al. [5]). Contrary, the HPLC analysis revealed that, at least in some samples, the mycotoxin accumulation following artificial inoculation was increased (between 1.457 mg kg -1 and 5.830 mg kg -1 ). The pathogenicity of 19 Fusarium isolates, both F.graminearum (13 isolates) and F.culmorum (six isolates), was analyzed in vitro by determining their influence on seeds germination and disease symptoms in seedlings of two wheat cultivars (Boema and Auradur). The selection of fungal isolates was based on the results obtained in molecular analysis (chemotype) as well as on previous determinations (Ittu & al. [5; 6]). It was shown that, after 48h, the germination rate presented a large variation among the isolates, comparing with the uninoculated seeds, taken as reference (100%) (table 3). 8792 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013

Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania Table 3. Inhibition of wheat seeds germination by different Fusarium isolates Fusarium Chemotype Inhibition of germination DON accumulation in code in wheat cultivar (%) plant material (mg kg -1 ) Boema Auradur Boema Auradur FG8713 15-ADON 43.33 27.78 0.1765 0.092 FG183 3-ADON 100* 75.28 4.599 4.259 F1239 15-ADON 93.33 62.22 0.379 0.189 F1266 15-ADON 40 1.12 0.074 0.033 F1056 3-ADON 84.44 28.2 5.034 3.371 F1265 15-ADON 100* 17.02 4.771 3.978 F1146 15-ADON 78.33 45.55 1.503 0.915 F1177 15-ADON 75.55 ND 0.305 ND F1231 15-ADON 93.3 ND 2.572 ND F1240 15-ADON 84.4 47.03 5.464 4.015 F1452 3-ADON 87.8 68.33 3.032 2.914 F1039 3-ADON 74.82 42.55 2.541 2.031 F1073 3-ADON 80.34 ND 2.131 ND F1553 3-ADON 69.42 ND 3.807 ND F1564 3-ADON 61.67 41.33 3.729 2.816 F1268 15-ADON 31.33 2.67 0.053 0.041 F1269 15-ADON 48.67 11.53 0.907 0.370 F1191 15-ADON 72.67 49.88 1.458 1.076 F981 15-ADON 45.33 ND 0.172 0.068 *total inhibition of germination Despite the good germination rate encountered in the presence of some fungal isolates, the seedlings didn t grow, being covered by mycelium, as in the case of F1239, F1265, F1231, and F1240, or died after five days of incubation (as for F1056) (fig.4). Fig.4. Inhibiton of wheat seedlings development by different Fusarium isolates (F22, F29 and F55, from left to right) Reduction of the length of seedling and significant symptoms of necrosis were observed after one week of incubation of wheat on plates containing Fusarium isolates. Among the 11 F.graminearum (15-ADON chemotype) isolates, the necrosis score (determined as described by Yli-Matila and Gagkaeva [26]) was 2.56±0.42 for Boema cultivar and 2.19±0.24 for Auradur cultivar, comparing with 2.96±0.02, the score for the reference fungal strain, F.graminearum FG183 (3-ADON chemotype). For F.culmorum (3- ADON chemotype) (six isolates), the necrosis score was higher in both cultivars: 2.82±0.17 and 2.31±0.20, respectively, the response of seedlings being more homogenous (fig.5). Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8793

C. P. CORNEA, F. ISRAEL-ROMING,*, M. CIUCA, C. VOAIDES Fig.5. Morphological aspects of wheat seedlings (Boema cultivar, left, and Auradur cultivar, right) after interaction with F28 fungal isolate. The accumulation of DON in wheat seeds inoculated with the selected fungal isolates varied: all the F.culmorum isolates determined high DON levels: 3.379±1.041 mg kg -1 for Boema cultivar, and 3.177±1.069 mg kg -1 for Auradur cultivar, comparing to F.graminearum isolates: 1.605±1.907 mg kg -1 for Boema cultivar, and 1.188±1.635 mg kg -1 for Auradur cultivar, respectively. Large amount of DON was detected in wheat inoculated with reference strain FG183: 4.599 mg kg -1 in Boema, and 4.259 mg kg -1 in Auradur cultivar, respectively. However, two Romanian isolates, F1056 and F1240, induced higher DON accumulation in plant material, comparing to reference strain FG183 (table 3). According to our knowledge, this is the first paper concerning the molecular identification of Fusarium species and corresponding trichothecene chemotypes in fungal isolates extracted from Romanian populations of pathogen. It proves that selected primers used in experiments were consistent, allowing the identification of prevalent Fusarium species and their specific DON chemotypes in all fungal isolates tested. The present study proved that F.culmorum isolated from Romanian wheat fields were exclusively 3-ADON chemotype, were more aggressive and induced a higher DON accumulation, comparing to coexisting F.graminearum isolates. The occurrence of 3-ADON chemotype poses a serious threat for food safety due to its higher toxigenic potential and its higher aggressiveness on certain wheat cultivar (C. Ohe & al. [15]; K.D. Puri and S. Zhong [18]). Acknowledgments This work was funded by the grant from the Romanian National Research Center for Program Management ( Management of risk of pre-harvest Fusarium mycotoxins contamination in wheat, PNCD 2-51040/2007, acronym GRIFOX). References 1. ALEXANDER N.J., MCCORMICK S.P., WAALWIJK C., VAN DER LEE T., PROCTOR R.H., 2011, The genetic basis for 3-ADON and 15-ADON trichothecene chemotypes in Fusarium, Fungal Genetics and Biology 48: 485 495 2. BAKAN B., DELVILLE-GIRAUD C., PINSON L., RICHARD-MOLARD D., FOURNIER E., BRYGOO Y., 2002, Identification by PCR of Fusarium culmorum strain producing large and small amounts of Deoxynivalenol, Appl.Environ.Microbiol. 68: 5472-5479. 3. DEMEKE T., CLEAR R.M., PATRICK S.K., GABA D., 2005, Species-specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis, Internat.J.Food Microbiol. 103: 271-284 4. GARDINER D.M., KAZAN K., MANNERS J.M., 2009, Nutrient profiling reveals potent inducers of trichothecene biosynthesis in Fusarium graminearum, Fungal Genetics and Biology 46: 604 613 5. ITTU M., CANĂ L., VOICA M., LUPU C., 2010, Multi-environment evaluation od disease occurence, aggressiveness and wheat resistance in wheat/fusarium pathosystem, Rom.Agric.Res. 27: 17-26 8794 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013

Natural occurrence of Fusarium species and corresponding chemotypes in wheat scab complex from Romania 6. ITTU M., CANA L., CIUCA M., VOAIDES C., CORNEA P., 2012, Phenotypic and marker assisted evaluation of aggressiveness versus wheat in some Romanian Fusarium populations, Rom.Agric.Res. 29: 289-296 7. JENNINGS P., COATES M.E., WALSH K., TURNER J.A., NICHOLSON P., 2004, Determination of deoxynivalenol- and nivalenol-producing chemotypes of Fusarium graminearum isolated from wheat crops in England and Wales, Plant Pathol. 53: 643-652 8. KIMURA M., TOKAI T., ANDO N.T., OHSATO S., FUJIMURA M., 2007, Molecular and genetic studies of Fusarium trichothecene biosynthesis: pathways, genes and evolution, Biosci.Biotechnol.Biochem. 71: 2105-2123 9. KONCZ K., NAAR Z., KISS A., SZECSI A., 2008, Determination of the trichothecene mycotoxin chemotypes of Fusarium graminearum isolates from Hungary by PCR assay, Cereal Res.Commun. 36: 637-639 10. KONIETZNY U., GREINER R., 2003, The application of PCR in the detection of mycotoxigenic fungi in foods, Brazilian J.Microbiol. 34: 283-300 11. LEE T., OH D.W., KIM H.S., LEE J., KIM Y.H., YUN S.H., LEE Y.W., 2001, Identification of deoxynivalenoland nivalenol-producing chemotypes of Gibberella zeae by using PCR, Appl.Environ.Microbiol. 67: 2966-2972 12. LESLIE F.J., SUMMERELL A.B., 2006. The Fusarium laboratory manual, Wiley-Blackwell Publishing, 388 pp 13. NICHOLSON P., SIMPSON D.R., WESTON G., REZANOOR H.N., LEES A.K., PARRY D.W., JOYCE D., 1998, Detection and quantification of F.culmorum and F.graminearum in cereals using PCR assays, Physiol.Molec.Plant Pathol. 53: 17-37 14. NIESSEN M.L., VOGEL R.F., 1998, Group specific PCR-detection of potential trichothecene-producing Fusarium-species in pure cultures and cereal samples, Syst. Appl.Microbiol. 21: 618-631 15. OHE C., GAUTHIER V., TAMBURIC-ILINCIC L., BRULE-BABEL A., DILANTHA FERNANDO W.G., CLEAR R., WARD T.J., MIEDANER T., 2010, A comparison of aggressiveness and deoxynivalenol production between Canadian Fusarium graminearum isolates with 3-acetyl and 15-acetyldeoxynivalenol chemotypes in field-grown spring wheat, Eur.J. Plant Pathol.127: 407-417 16. PASQUALI M., GIRAUD F., BROCHOT C., COCCO E., HOFFMAN L., BOHN T., 2010, Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat, Internat.J.Food Microbiol. 137: 246-253 17. PASQUALI M., BEYER M., BOHN T., HOFFMAN L., 2011, Comparative analysis of genetic chemotyping methods for Fusarium: Tri13 polymorphism does not discriminate between 3- and 15-acetylated deoxynivalenol chemotypes in Fusarium graminearum, J.Phytopathol. 159: 700-704 18. PURI K.D., ZHONG S., 2010, The 3-ADON Population of Fusarium graminearum found in North Dakota is more aggressive and produces a higher level of DON than the prevalent 15-ADON population in spring wheat, Phytopathology 100: 1007-1014 19. RUPP, H.S., 2002, Determination of deoxynivalenol in whole wheat flour and wheat bran, Journal AOAC 85(6): 1355-1359 20. STEPIEN L., POPIEL D., KOCZYK G., CHELKOWSKI J., 2008, Wheat-infecting Fusarium species in Poland their chemotypes and frequencies revealed by PCR assay, J.Appl.Genet. 49: 433-441 21. TOTH B., MESTERHAZY A., NICHOLSON P., TEREN J., VARGA J., 2004, Mycotoxin production and molecular variability of European and American isolates of F.culmorum, Eur.J.Plant Pathol. 110: 587-599 22. WAALWIJK C., KASTELEIN P., DE VRIES I., KERÉNYI Z., VAN DER LEE T., HESSELINK T., KÖHL J., KEMA G., 2003, Major changes in Fusarium spp. in wheat in the Netherlands, Eur.J.Plant Pathol. 109: 743-754 23. WAGACHA J.M., MUTHOMI J.W., 2007, Fusarium culmorum: infection process, mechanisms of mycotoxin production and their role in pathogenesis in wheat, Crop Protection 26: 877-885 24. WANG J.H., LI H.P., QU B., ZHANG J.B., HUANG T., CHEN F.F., LIAO Y.C., 2008, Development of a generic PCR detection of 3-acetyldeoxynivalenol, 15-acetyl deoxynivalenol and nivalenol chemotypes of F.graminearum clade, Internat.J. Molec.Sci. 9: 2495-2504 25. WARD T.G., BIELAWSKI J.P., KISTLER H.C., SULLIVAN E., O'DONNELL K., 2002, Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium, Proc.Natl.Acad.Sci USA 99: 9278 9283. 26. YLI-MATILA T., GAGKAEVA T., 2010, Molecular chemotyping of Fusarium graminearum, F.culmorum, and F.cerealis isolate from Finland and Russia, in Molecular identification of fungi, Y.Gherbawy and K.Voigt (eds), Springer-Verlag Berlin Heidelberg, pp: 159-177 27. ZHANG J.B., LI H.P., DANG F.J., QU B., XU Y.B., ZHAO C.S., LIAO Y.C., 2007, Determination of trichothecene mycotoxin chemotypes ans associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China, Mycol.Res. 111: 967-975 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8795