Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 351 HBsAg HBs S N- [ ] (HBV)HBsAg+ HBs S (MHR) N- HBsAg+ HBs 284 HBsAg+ HBs 314 HBsAg HBV S 1 MHR N- N- S/S HepG2 HBsAg+ HBs MHR N- 11.3%(32/284) HBsAg 2.9%(9/314)(P<0.01) HBsAg+ HBs 72 (HCC) N- 46.9%(15/32) 22.6%(57/252)(P<0.01) 1 s116-118tst NST+s131-133TSM NST sp120 +G145D 3 98.0% 2.0% 2.5% 2 s130-132gts NSS N- 17.6% sp120 +G145D 31% HBsAg 99% N- HBsAg N- sp120 +G145D HBsAg HBV S MHR N- HBsAg+ HBs HCC S MHR N- +sp120 +sg145d HBsAg [ ] S N- [ ] R512.62 [ ] A [ ] 0577-7402(2016)05-0351-07 [DOI] 10.11855/j.issn.0577-7402.2016.05.01 Implications of newly-added N-glycosylation mutation of hepatitis B virus S-gene in patients with coexistence of HBsAg and antihbs LU Shan-shan 1, LI Xiao-dong 2, LUO Sheng-dong 3, QIAO Yan 1, XU Zhi-hui 2, LIU Yan 2, LI Bo-an 2, XU Dong-ping 2*, LI Jin 4* 1 Graduate School of Guilin Medical University, Guilin, Guangxi 541004, China 2 Research Center for Clinical and Translational Medicine, 4 Department of Medical Administration, 302 Hospital of PLA, Beijing 100039, China 3 State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China * Corresponding author. XU Dong-ping, E-mail: xudongping302@sina.com; LI Jin, E-mail: lijin302@hotmail.com This work was supported by the National Natural Science Foundation of China (81373136, 81271847, 81572010) [Abstract] Objective To analyze the characteristics of newly added N-glycosylation mutation in major hydrophilic region (MHR) of HBV S gene in patients with coexistence of HBsAg and antihbs, and reveal the generation mechanism and clinical implications of the coexistence. Methods HBV S genes from 284 patients with HBsAg+antiHBs and 314 patients with single HBsAg were amplified respectively for sequence analysis. A chronic hepatitis B (CHB) patient with HBsAg+antiHBs in MHR was found to harbor a novel double N-glycosylation mutation and selected for further study. Recombinant vectors harboring the novel mutant or control PreS/S genes were constructed and transfected in HepG2 cells respectively for phenotypic analysis, and the effects of the mutations on HBV duplication and antigenicity were investigated. Results The detection rate of MHR N-glycosylation mutation was significantly higher in HBsAg+antiHBs group than in single HBsAg group (11.3% vs. 2.9%, P<0.01, respectively). In HBsAg+antiHBs cohort, the proportion of hepatocellular carcinoma (HCC) patients accounted for 46.9%(15/32) in patients with N-glycosylation mutation at the time of testing; by contrast, the number was 22.6%(57/252) in patients with non-n-glycosylation mutation (P<0.01). N-glycosylation mutational pattern of the novel strain was s116-118tst NST+s131-133TSM NST concomitant with sp120 [ ] (81373136 81271847 81572010) [ ] [ ] 541004 ( ) 100039 302 ( ) ( ) 100071 ( ) [ ] E-mail xudongping302@sina.com E-mail lijin302@hotmail.com
352 2016 5 1 41 5 deletion+g145d mutation. The novel mutants accounted for 98.0%, 2.0% and 2.5%, respectively, of viral clones in three sequential serum samples. Mutants with single N-glycosylation mutation s130-132gts NSS without sp120 deletion+g145d were detected in sample 2, accounting for 17.6% of viral clones. Compared to the wild-type, the novel mutant had an increase of 31% in replication capacity, but a decrease of 99% in HBsAg level. Immunofluorescence showed that elimination of the two additional N-glycosylation mutations only partly restored HBsAg detection by antihbs, suggesting that sp120 deletion+g145d mutation also attenuated HBsAg antigenicity. Conclusions Additional N-glycosylation mutation in MHR of HBV S gene is associated with coexisting HBsAg+antiHBs, and the twoparameterstogethermightbeabetterriskfactor for HCC occurrence. Combination of two additional N-glycosylation mutation, sp120 deletion and sg145d mutation may co-play a role in silence of HBsAg antigenicity. [Key words] hepatitis B virus; S gene; mutation; N-glycosylation; antigenicity (HBV) HBsAg HBs HBs HBsAg HBs [1-2] HBV HBsAg HBs HBsAg+ HBs HBV DNA HBsAg+ HBs HBsAg HBs [3-4] HBV S HBV HBsAg+ HBs [5-6] HBV S (nt 155-835) 226 (aa) S S (major hydrophilic region MHR aa 99-169) N- s146-148nct N- NXT/S(X P ) N- 216 HBsAg+ HBs S MHR 47 N- ( N- ) MHR N- HBs HBsAg [7] 284 HBsAg+ HBs HBV S N- 1 N- sp120 +G145D S N- HBsAg+ HBs 1 1.1 284 HBsAg+ HBs 314 HBsAg HBV 302 2008 2012 284 HBsAg+ HBs 231 53 43.8±14.8 (CHB)99 (LC)113 (HCC)72 HBsAg ( ) 4354.0(1640.8 6507.0)COI HBs 48.6(23.9 115.4)U/L HBV DNA log 10 (4.8±2.2)U/ml 314 HBsAg 268 46 44.5±13.6 CHB 108 LC 103 HCC 103 HBsAg 5866.0(3034.8 7204.3)COI HBs HBV DNA log 10 (5.6±1.6)U/ml 1 S MHR N- CHB S12931 57 2000 HBsAg HBV DNA 2011 1 302 HBsAg HBs HBV DNA 3.07 10 7 U/ml 2012 9 302 HCC 3 80 3 1 ID Date ALT (U/L) AST (U/L) 1 S12931 Tab.1 Clinical indices of sample S12931 HBsAg (U/ml) Anti-HBs (U/L) HBeAg (COI) Anti-HBe (COI) Anti-HBc (COI) HBV DNA (U/ml) Diagnosis * 2010-12-28 191 194 0.3 48.31 74.15 1.04 0.005 9.65 10 6 CHB 1 2011-01-11 84 95 0.848 61.97 67.03 1.08 0.004 3.07 10 7 CHB * 2012-09-29 21 21 9.4 2 1.49 1.06 0.008 <40 HCC 2 2012-11-12 19 24 5.2 6.28 0.733 0.491 0.008 <40 HCC 3 2015-03-26 21 22 3.11 <2 0.697 1.35 0.009 <40 HCC *Represents the individual with the clinical information, but without serum; CHB. Chronic hepatitis B; HCC. Hepatocellular carcinoma
Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 353 1.2 DNA HBV DNA SFDA PCR ( ) 100 40U/ml HBsAg Roche Elecsys Roche Cobas e601 0.05U/ml peasy-t1 Simple Trans-T1 His FITC HRP Hind Xho I BstE Sph NEB pcdna3.1(-)/myc-his A Invitrogen ptriex-mod-1.1hbv Zoulim X-treme GENE HD Roche HBsAg Santa 1.3 1.3.1 PCR HBV S 284 HBsAg+ HBs 314 HBsAg HBV DNA PCR S ( ZL 200910092331.1 10U/ml) 1 Rtup3/ SB1R 2 Rtup4/SB2R PCR (nt 54-1278) 2 2 PCR Tab.2 PCR amplification primers Primer Sequence(5' 3') Site Rtup3 AGTCAGGAAGACAGCCTACTCC nt 3146-3167 Rtup4 TTCCTGCTGGTGGCTCCAGTTC nt 54-75 PSup3 TCGCAGAAGATCTCAATCTCG nt 2146-2436 SB1R AGGTGAAGCGAAGTGCACAC nt 1577-1596 Up-BstE ATGGTCACCATATTCTTGGGAACAAG nt 2815-2838 SB2R TTCCGCAGTATGGATCGGCAG nt 1258-1278 yef3 CCTGCTCAAACCAGCTCTATGT nt 534-554 yer3 ACATAGAGCTGGTTTGAGCAGG nt 534-554 TuF1 AGGATCATCAACCACCAGCACG nt 487-508 TuR1 TCCCGTGCTGGTGGTTGATGAT nt 490-511 TuF2 TGCTCCAGCAACCTCTACGTTTC nt 535-557 TuR2 GAAACGTAGAGGTTGCTGGAGC nt 534-557 His-Up GGCTCGAGATGGAGAGCACAACATCAGG nt 155-174 His-Down GGAAGCTTCCAGATGTATGCCCAAAGAC nt 816-833 1.3.2 HBV S/S GI:79013072 (S12931)3 DNA PCR S/S PSup3/SB1R 2 Up-BstE /SB2R PCR (nt 2815-1278) T 40~50 1.3.3 ptriex-mod-1.1hbv BstE Sph 1 N- (M1) (WT) 2 N- (M2) ptriex-mod1.1-hbv ptriex-m1 ptriex-w T ptriex-m2 1.3.4 PCR HBV S s116-118 ( )s131-133 N- ptriex-m1 Up-BstE /TuR1 TuF1/SB2R Up-BstE /TuR2 TuF2/SB2R PCR BstE Sph PCR ptriex ptriex-m1'a ptriex-m1'b ptriex-m1'a Up-BstE /TuR2 TuF2/SB2R BstE Sph ptriex-m1'c ptriex-m2 Up-BstE /yer3 yef3/sb2r BstE Sph PCR ptriex-m2'a 1.3.5 pcdna3.1/myc-his(-)a ptriex-m1/m1'a/m1'b/m1'c TriEx-M2/M2'a His-Up/His-Down HBV S (nt 155-835) Hind Xho PCR pcdna3.1/myc-his(-)a His-M1/M1'a/M1'b/M1'c/M2/M2'a ptriex-w T His-WT 1.3.6 DNA HBsAg HBV ptriex HepG2 3d HBV [8] PCR 20ml DNase PCR HBV DNA HBsAg ( cobas E601) 1.3.7 Western blotting HBV S His-M1 HepG2 HBV S HepG2 4 10 5 / 6 24h 12 24 36 48 60 72h 10min 12%SDS- PAGE 5% His 1.5h PBST HRP 0.5h ECL Tanon5200 7 His HepG2 36h PNGase F
354 2016 5 1 41 5 1.3.8 1d 6 HepG2 7 His 48h 100ml 4% 10min 100ml 0.2% Trixon-100 5min PBS 5% BSA 30min His ( 1:200) HBsAg ( 1:200)37 1h PBS FITC ( 1:200)37 30min PBS 50% 2 2.1 N- 284 HBsAg+ HBs MHR N- 11.3%(32/284) 314 HBsAg 2.9%(9/314) (P<0.01) HBsAg+ HBs 72 (HCC) N- 46.9%(15/32) 22.6%(57/252 P<0.01) 32 N- 3 CHB LC 39 29 20 HCC HBsAg 103 HCC 6 N- 2.2 N- 3 8 (1) 7 HBV DNA ( 10 9 copies/ml) 6 5 4 3 2 1 3 N- 98.0% 2.0% 2.5% 2 sg130n+t131s s130-132gts NSS sp120 +G145D 2.3 S/S ptriex-mod-1.1hbv S pcdna3.1(-)-myc-his A M1 st116n+p120deletion+g130a+t131n +G145D s116-118nst 131-133NST N- M1'a M1'b M1'c s116-118nst 131-133NST M2 sg130n+t131s s130-132nss M2'a WT 2.4 HBV HBV DNA HBV HBV WT M1 31%(P<0.05) ( 1A) HBV DNA M1 M1'a M1'b M1'c WT 88% 46% 43% 35%(P<0.05 1B) M2 M2'a 5 (1) HBV DNA ( 10 6 copies/ml) 4 (1) (1) (1) 3 2 1 0 0 M1 M1'a M1'b M1'c M2 M2'a WT A M1 M1'a M1'b M1'c M2 M2'a WT B 1 HBV (A) (B) HBV DNA Fig.1 Quantitation of HBV DNA in intracellular replicative intermediates (A) and supernatant (B) M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120deletion+g130a+ G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type. (1)P<0.05 compared with wild-type 2.5 HBsAg ptriex-mod-1.1hbv HBsAg M1 M1'a M1'b M1'c HBsAg M2 M2'a HBsAg WT ( 2) 2.6 HBV S Western blotting His-M1 HepG2 His HBsAg-His 12h 24h ( 3A) His 7 His HBsAg-His 1 3kD( 3B) 27kD ( 3C) HBs M1 M1'a M1'b M1'c HBsAg-His M2 M2'a HBsAg- His WT ( 3D) 2.7 His HBs
Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 355 HBsAg (U/ml) 50 40 30 20 10 0 M1 M1'a M1'b M1'c M2 M2'a WT 2 HBsAg Fig.2 Quantitation of HBsAg in supernatant M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp 120deletion+G130A+T131N+G145D; M1'b. st116n+p120deletion +G130A+G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type 36kD 33kD 27kD 36kD 33kD 27kD 12h 24h 36h 48h 60h 72h M1 M1'a M1'b M1'c M2 M2'a WT NC PNGaseF Plasmids M1'c M1 M1'a M1'b M1'c M2 M2'a M2'2 NC 27kD A B C HBsAg-His M1 M1'a M1'b M1'c M2 M2'a WT NC His 7 D HBs M1 3 HBsAg-His Western blotting M1'a M1'b M1'c Fig.3 Expression of intracellular HBsAg-His fusion proteins WT (Western blotting) M2 M2'a WT ( 4) A. Dynamical expression of HBsAg-His fusion protein of M1 mutant using anti-his; B. Expression of seven HBsAg-His fusion proteins using anti-his; C. Expression of seven deglycosylated HBsAg-His fusion proteins using anti-his; D. Expression of seven HBsAg-His fusion proteins 3 using antihbs. M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120 HBV S S HBsAg S deletion+g130a+g145d; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type M1 M1'a M1'b M1'c M2 M2'a WT Anti-His Anti-HBsAg 4 HBsAg-His Fig.4 Immunofluorescence analysis of HBsAg-His fusion proteins M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120deletion+g130a+ G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type S HBs S MHR (aa 124-147) HBsAg G145R [9] NXT/S(X P)N- N- N- 3kD HBsAg+ HBs HBV S N- [10-13] HBsAg+ HBs HCC [14-15] N- HBsAg HBs
356 2016 5 1 41 5 DNA HCC [16] HBsAg+ HBs HBV S MHR N- HBsAg+ HBs HCC N- N- N- 3 40 HCC HBsAg+ HBs MHR N- HCC s116-118tst NST+ s131-133tsm NST+sP120 +G145D HBs HBsAg HBsAg Western blotting HBsAg HBs N- HBsAg WT s130-132gts NSS N- sp120 +G145D HBsAg WT N- sp120 +G145D -HBs HBsAg sp120t sg145d HBsAg [17-19] HBsAg HBsAg -HBs HBsAg HBV DNA [20-21] N- HBsAg HBV DNA HBsAg HBV S MHR N- HBsAg+ HBs HCC HCC HBsAg MHR N- sp120 sg145 [1] Yuan Q, Wu CX, Liu FF, et al. Clinical analysis of occult hepatitis B virus infection in 110 HBsAg-negative patients[ J]. Med J Chin PLA, 2015, 40(3): 133-136. [,,,. HBsAg HBV :110 [J]., 2015, 40 (3): 133-136.] [2] Wang Y, Yan YP, Du J, et al. Tne dynamic changes in serologic HBV markers in infants born by HBsAg-carrying mothers[ J]. Med J Chin PLA, 2011, 36(10): 1041-1044. [,,,. HBsAg HBV [J]., 2011, 36(10): 1041-1044.] [3] Yu YQ, Zhang WH. Progress in antiviral therapy to prevent HBV recurrence in patients of post-liver transplantation[ J]. Chin J PractInternMed,2014, 34(6): 553-557. [,. [J]., 2014, 34(6): 553-557.] [4] Guo WS, Liu Q, Guo YH, et al. Serological survey of hepatitis B among adult population in Henan[ J]. J Zhengzhou Univ (Med Sci), 2014, 49(1): 53-59. [,,,. 2012 [J]. ( ), 2014, 49(1): 53-59.] [5] DingF,YuHG,LiYX,et al. Sequence analysis of the HBV S protein in Chinese patients with coexisting HBsAg and anti- HBs[ J]. J Med Virol, 2015, 87(12): 2067-2073. [6] Lada O, Benhamou Y, Poynard T, et al. Coexistence of hepatitis B surface antigen (HBsAg) and anti-hbs antibodies in chronic hepatitis B virus carriers: influence of "a" determinant variants[ J]. J Virol, 2006, 80(6): 2968-2975. [7] YuDM,LiXH,MomV,et al. N-glycosylation mutations within hepatitis B virus surface major hydrophilic region contribute mostly to immune escape[ J]. J Hepatol, 2014, 60(3): 515-522. [8] JiD,LiuY,SiLL,et al. Variable influence of mutational patterns in reverse-transcriptase domain on replication capacity of hepatitis B virus isolates from antiviral-experienced patients[ J]. Clin Chim Acta, 2011, 412(3-4): 305-313. [9] Kajiwara E, Tanaka Y, Ohashi T, et al. HepatitisBcausedbya hepatitis B surface antigen escape mutant[ J]. J Gastroenterol, 2008, 43(3): 243-247. [10] Liu W, Hu T, Wang X, et al. Coexistence of hepatitis B surface antigen and anti-hbs in Chinese chronic hepatitis B virus patientsrelatingtogenotypecandmutationsinthesandp gene reverse transcriptase region[ J]. Arch Virol, 2012, 157(4): 627-634. [11] Wang L, Liu H, Ning X, et al. Sequence analysis of the S gene region in HBV DNA from patients positive for both HBsAg and HBsAb tests[ J]. Hepatol Res, 2010, 40(12): 1212-1218. [12] Chen Y, Qian F, Yuan Q, et al. Mutations in hepatitis B virus DNA from patients with coexisting HBsAg and anti-hbs[ J]. J Clin Virol, 2011, 52(3): 198-203. [13] Brunetto MR. Chance and necessity of simultaneous HBsAg and anti-hbs detection in the serum of chronic HBsAg carriers[ J]. J Hepatol, 2014, 60(3): 473-475. [14] Seo SI, Choi HS, Choi BY, et al. Coexistence of hepatitis B surface antigen and antibody to hepatitis B surface may increase the risk of hepatocellular carcinoma in chronic hepatitis B virus infection: a retrospective cohort study[ J]. J Med Virol, 2014, 86(1): 124-130. [15] Jang JS, Kim HS, Kim HJ, et al. Association of concurrent hepatitis B surface antigen and antibody to hepatitis B surface antigen with hepatocellular carcinoma in chronic hepatitis B virus infection [ J]. J Virol, 2009, 81(9): 1531-1538. [16] Pollicino T, Cacciola I, Saffioti F, et al. Hepatitis B virus PreS/ S gene variants: pathobiology and clinical implications[ J]. J Hepatol, 2014, 61(2): 408-417. [17] Tian Y, Xu Y, Zhang Z, et al. The amino acid residues at positions 120 to 123 are crucial for the antigenicity of hepatitis B surface antigen[ J]. J Clin Microbiol, 2007, 45(9): 2971-2978. [18] Wu C, Deng W, Deng L, et al. Amino acid substitutions at positions 122 and 145 of hepatitis B virus surface antigen
Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 357 (HBsAg) determine the antigenicity and immunogenicity of HBsAg and influence in vivo HBsAg clearance[ J]. J Virol, 2012, 86(8): 4658-4669. [19] Colson P, Borentain P, Motte A, et al. Clinical and virological significance of the co-existence of HBsAg and anti-hbs antibodies in hepatitis B chronic carriers[ J]. Virology, 2007, 367(1): 30-40. [20] Huang CH, Yuan Q, Chen PJ, et al. Influence of mutations in hepatitis B virus surface protein on viral antigenicity and phenotype in occult HBV strains from blood donors[ J]. J Hepatol, 2012, 57(4): 720-729. [21] Chen JH, Liu Y, Xu ZH, et al. Characteristics of S gene mutation in patients with occult HBV infection[ J]. Med J Chin PLA, 2015, 40(3): 178-183. [,,,. S [J]., 2015, 40(3): 178-183. ] ( 2015-12-29 2016-03-31) ( )