125 I-C5a (cpm) Fluorescnece Em 520nm a 4000 3000 2000 1000 c 0 5000 4000 3000 2000 Blank C5a C3a 6 0.3 mm C3a 7 9 10 11 12 13 15 16 0.3 mm C5a 0 300 600 900 1200 Time (s) 17 Fluorescnece Em 520nm Fluorescnece Em 520nm b 5000 4000 0.3 mm C3a 3000 1 mm C3a 2000 0 300 600 900 1200 Time (s) d 5000 4000 0.3 mm C3a 3000 10 mm 17 2000 0 300 600 900 1200 Time (s) Supplementary Figure S1. Selectivity and biological evaluations of agonist 17. (a) Small molecule C3aR ligands do not bind to C5aR. Error bars are means ± SEM. (b-d) Desensitization assay. (b) HMDM was treated with 0.3 μm of C3a ligand at t 0 to desensitize the C3a receptor. 1 μm of C3a was then injected at t 920 (s) to confirm C3aR desensitization. (c) Cells were first desensitized by 0.3 μm C3a ligand at t 0, then 0.3 μm C5a was injected at t 920 (s) to make sure only C3aR was desensitized. (d) Cells were first desensitized by 0.3 μm of C3a ligand at t 0, then agonist 17 at 10 μm were administered at t 920 (s). Compound 17 is selective for C3aR at 10 μm.
Supplementary Figure S2. Synthesis of oxazole compounds (7 10). Reagents and conditions: a) BOP, DIPEA, DMF; b) DAST, THF -78 C; c) CBrCl 3, DBU, DCM -40 C to RT; d) NaOH, MeOH, H 2 O; e) H-Arg-OEt, HBTU, DIPEA, DMF.
Supplementary Figure S3. Synthesis of Boc-(Leu-Thiazole)-Arg (11). Reagents and conditions: a) ClCO 2 Et, Et 3 N, THF, -20 C; b) Lawesson s reagent, DME; c) pyridine, EtOH; d) LiOH, MeOH, H 2 O; e) H-Arg-OEt, HBTU, DIPEA, DMF. f) LiOH, MeOH, H 2 O.
Supplementary Figure S4. Synthesis of imidazole compounds (12 14). Reagents and conditions: a) (i) NaNO 2, AcOH/H 2 O; (ii) H 2, EtOH, 10% Pd/C 15 psi; b) Cbz-L-Leu- OH, HBTU, DIPEA, DMF; c) NH 4 OAc, AcOH, microwave 150 C, 30 min; d) H 2, 10% Pd/C, MeOH, 40 psi; e) Boc 2 O, CH 2 Cl 2 ; f) NaOH, H 2 O, EtOH, 120 C; g) H-Arg-OEt, HBTU, DIPEA, DMF; h) NaOH, H 2 O, EtOH, RT; i) MeI, NaH, DMF.
Supplementary Figure S5. Synthesis of Boc-(Leu-1,3,4-Oxadiazole)-Arg (15). Reagents and conditions: a) N 2 H 4, EtOH, RT; b) Et 3 N, CH 2 Cl 2 ; c) TsCl, Et 3 N, CH 2 Cl 2 ; d) H-Arg-OEt, MeOH, DIPEA, microwave 100 C; e) NaOH, H 2 O, EtOH, RT.
Supplementary Figure S6. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 3 Ac-Leu-Ala-Arg.
Supplementary Figure S7. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 4 Boc-Leu-Ala-Arg.
Supplementary Figure S8. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 5 H-(Leu-Oxazole)-Arg.
Supplementary Figure S9. 1 H NMR (600 MHz, DMSO-d 6 ) compound 6 Ac-(Leu-Oxazole)-Arg.
Supplementary Figure S10. 1 H NMR (600 MHz, DMSO-d 6 ) compound 7 Boc-(Leu-Oxazole)-Arg.
Supplementary Figure S11. 1 H NMR (600 MHz, DMSO-d 6 ) compound 8 Ac-(Ile-Oxazole)-Arg.
Supplementary Figure S12. 1 H NMR (600 MHz, DMSO-d 6 ) compound 9 Ac-(Cha-Oxazole)-Arg.
Supplementary Figure S13. 1 H NMR (600 MHz, DMSO-d 6 ) compound 10 Ac-(Ala-Oxazole)-Arg.
Supplementary Figure S14. 1 H NMR (600 MHz, DMSO-d 6 ) compound 11 Ac-(Leu-Thiazole)-Arg.
Supplementary Figure S15. 1 H NMR (600 MHz, DMSO-d 6 ) compound 12 Ac-(Leu-Imidazole)-Arg.
Supplementary Figure S16. 1 H NMR (600 MHz, DMSO-d 6 ) compound 13 Boc-(Leu-N-Me(Y)-Imidazole)-Arg.
Supplementary Figure S17. 1 H NMR (600 MHz, DMSO-d 6 ) compound 14 Boc-(Leu-N-Me(X)-Imidazole)-Arg.
Supplementary Figure S18. 1 H NMR (600 MHz, DMSO-d 6 ) compound 15 Boc-(Leu-1,3,4-Oxadiazole)-Arg.
Supplementary Figure S19. 1 H NMR (600 MHz, DMSO-d 6 ) compound 16 3-Indolyl-(Leu-Imidazole)-Arg.
Supplementary Figure S20. 1 H NMR (600 MHz, DMSO-d 6 ) compound 17 3-Indolyl-(Leu-Oxazole)-Arg.
Supplementary Table S1. Primer sequences for target genes. Name Forward Reverse CCL3 CCCACATTCCGTCACCTGCTCAG AGCAGCAAGTGATGCAGAGAACTG EGR1 CGAGCACCTGACCGCAGAGTCT GGGGGCAGTCGAGTGGTTTGG FOSB GACCCTCAGCCCTGGCCTTT CAGCCCCTCACTGCCTTCCT IL1β CCTCTTCGAGGCACAAGGCACAA TGGCTGCTTCAGACACTTGAGCAAT IL6 GCCCACCGGGAACGAAAGAGA GACCGAAGGCGCTTGTGGAGAAG IL8 ACCACCGGAAGGAACCATCTCACT CTTGGCAAAACTGCACCTTCACAC TNF TCTGGCCCAGGCAGTCAGATC CACTGGAGCTGCCCCTCAGC 18S CGGCCGGTACAGTGAAACTG GCGCCCGTCGGCATGTATTA
Supplementary Methods Solid Phase Syntheses All amino acids and coupling reagents were purchased from Chem-Impex International Inc. Diisopropylethylamine (DIPEA), DMF and TFA were obtained from Auspep Pty Ltd., Australia. All solid phase syntheses were carried out on Wang resin (100-200 mesh, 1.1 mmol/g loading). Short peptides 2-4 were synthesized using standard SPPS Fmoc chemistry. The peptides were cleaved from resin using 20% TFA in CH 2 Cl 2 before purification by reverse phase HPLC and lyophilisation. Leu-Ala-Arg (2). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.58 (br s, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.09 (br s, 1H), 4.03 (m, 1H), 3.89 (t, J = 7.3 Hz, 1H), 3.65 (t, J = 6.5 Hz, 1H), 3.16-3.06 (m, 2H), 1.76 (m, 1H), 1.69-1.46 (m, 6H), 1.37 (d, J = 7.0 Hz, 1H), 1.30 (d, J = 7.2 Hz, 1H), 0.84 (2 sets of d, J = 6.3 Hz, 6H); HRMS (m/z): [MH] + calc. for C 15 H 31 N 6 O + 4, 359.2401; found, 359.2401. Ac-Leu-Ala-Arg (3). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.21 (d, J = 6.3 Hz, 1H), 8.18 (d, J = 8.2 Hz, 1H), 8.07 (d, J = 6.6 Hz, 1H), 4.20 (m, 1H), 3.15-3.06 (m, 2H), 1.91 (s, 3H), 1.82 (m, 1H), 1.66 (m, 1H), 1.58-1.41 (m, 5H), 1.27 (d, J = 7.2 Hz, 3H), 0.82 (d, J = 6.6 Hz, 3H), 0.77 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 176.3, 174.8, 174.5, 174.3, 156.9, 53.2, 52.5, 49.7, 40.6, 39.9, 28.2, 24.3, 24.2, 22.1, 21.6, 20.8, 16.3. HRMS (m/z): [MH] + calc. for C 17 H 33 N 6 O + 5, 401.2507; found, 401.2507. Boc-Leu-Ala-Arg (4). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.20 (br m, 1H), 7.08 (br s, 1H), 6.80 (br s, 1H), 4.24 (m, 1H), 3.92 (m, 1H), 3.14-3.05 (m, 2H), 1.81 (m, 1H), 1.66 (m, 1H), 1.59-1.49 (m, 3H), 1.44-1.37 (m, 2H), 1.33-1.25 (m, 12H), 0.82 (d, J = 6.6 Hz, 3H), 0.78 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 176.2, 175.6, 174.5, 157.5, 156.9, 81.4, 53.3, 53.0, 49.6, 40.7, 40.1, 28.1, 27.6, 24.3, 24.2, 22.1, 20.7, 16.4. HRMS (m/z): [MH] + calc. for C 20 H 39 N 6 O + 6, 459.2926; found, 459.2926. Solution Phase Syntheses Synthesis of Boc-(Leu-Oxazole)-Arg (7). The Boc-L-Leu-OH amino acid (7a, 16.0 g, 64.3 mmol) in DMF (130 ml) was activated with BOP (28.4 g, 64.3 mmol) for 15 min
before the addition of DL-serine methyl ester hydrochloride (10.0 g, 64.3 mmol) and DIPEA (22.4 ml, 128.6 mmol). The reaction mixture was stirred at RT for 1 h. The DMF in the reaction mixture was evaporated under high vacuum and the residue was redissolved in EtOAc (100 ml) and washed with sat. NaHCO 3 (2 70 ml). The organic extract was dried over MgSO 4, filtered and concentrated in vacuo to give product 7b (ESI-MS: m/z 333.2 [MH] + ). The crude product (7b, 9.00 g, 26.9 mmol) was dissolved in anhydrous DCM (100 ml) and stirred under N 2 at -78 C before dropwise addition of DAST (5.3 ml, 40.3 mmol) over 2 min. The reaction mixture was stirred at -78 C for 1 h. then Na 2 CO 3 (14.2 g, 134.5 mmol) was added and the reaction was warmed to RT and stirred for 1 h. The solution was diluted with DCM (50 ml) and washed with sat. NaHCO 3 (2 80 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (7c, ESI-MS: m/z 315.2 [MH] + ) was used for the next step without purification. To a stirred solution of oxazoline 7c (3.40 g, 10.9 mmol) at -40 C in anhydrous DCM (50 ml) was added CBrCl 3 (3.6 ml, 36 mmol) then DBU (6.2 ml, 41.4 mmol) was added dropwise and the reaction mixture was slowly warmed to RT and stirred overnight. The reaction mixture was concentrated in vacuo. The residue was purified by flash column chromatography (SiO 2, 20% EtOAc in petroleum ether, R f 0.2) to give the oxazole product 7d as a pale yellow solid (1.60 g, 46% yield). 1 H NMR (600 MHz, CDCl 3 ), δ 8.16 (s, 1H), 5.05 (m, 1H), 4.97 (m, 1H), 3.90 (s, 3H), 1.75-1.67 (m, 2H), 1.62 (m, 1H), 1.41 (s, 9H), 0.94 0.92 (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z 313.2 [MH] + ; t R = 11.5 min (20 100% B in 10 min gradient plus 100% B for further 10 min). A solution of the purified 7d (1.60 g, 5.1 mmol) in MeOH (18 ml) was treated with 3 M NaOH (6 ml) and the reaction mixture was stirred at RT for 30 min until the reaction went to completion as monitored by MS. The MeOH was concentrated in vacuo and the residual aqueous solution was acidified with 2 M HCl (10 ml) and extracted with EtOAc (2 15 ml). The organic extracts were combined, washed with brine (1 20 ml) and dried over MgSO 4, filtered and concentrated in vacuo to give 7e as a white powder. 1 H NMR (600 MHz, CDCl3), δ 8.14 (s, 1H), 5.03 (m, 1H), 4.95 (m, 1H), 1.73 1.65 (m, 2H), 1.60 (m, 1H), 1.39 (s, 9H), 0.91 (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z 299.2 [MH] + ; t R = 10.4 min (20 100% B in 10 min gradient plus 100% B for further 10 min). The Boc-L-Leu-oxazole acid (7e, 0.11 g, 0.37 mmol) in DMF (0.8 ml) was activated with BOP (0.16 g, 0.37 mmol) for 10 min before the addition of H-Arg-OEt (0.10 g, 0.37 mmol) and DIPEA (0.13 ml, 0.74 mmol). The reaction mixture was stirred at RT overnight, then diluted with EtOAc (2 ml) and washed with sat. NaHCO 3 (2 2
ml). The organic extract was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (~0.10 g) was dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 2 ml) and stirred until the reaction went to completion. The EtOH in the reaction was concentrated in vacuo and the aqueous solution was acidified with 2 M HCl (1 ml) and extracted with EtOAc (3 2 ml). Combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by rphplc to yield 7 as the trifluoroacetate salt (75 mg, 45%). Compounds 8-10 were synthesized by following the same synthetic procedures for compound 7. Boc-(Leu-Oxazole)-Arg (7). 1 H NMR (600 MHz, DMSO-d 6 ), 8.58 (s, 1H), 8.16 (d, J = 7.8 Hz, 1H), 7.56-7.54 (m, 2H), 4.73 (m, 1H), 4.40 (m, 1H), 3.46 (q, J = 7.2 Hz, 2H), 1.89-1.45 (m, 7H), 1.37 (s, 9H), 0.89 (dd, J = 12, 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.0, 165.0, 160.0, 156.6, 155.2, 142.1, 135.3, 78.4, 51.2, 46.9, 41.1, 40.3, 28.1, 27.9, 25.3, 24.1, 22.7, 21.4. HRMS (m/z): [MH] + calc. for C 20 H 34 N 6 O + 6, 455.2613; found, 455.2752; t R = 7.7 min (20-100% B in 10 min gradient). Boc-(Ile-Oxazole)-Arg (8). 1 H NMR (400 MHz, DMSO-d 6 ), 8.59 (s, 1H), 8.17 (d, J = 5.2 Hz, 1H), 7.58 (d, J = 5.6 Hz, 1H), 7.46 (t, J = 3.8 Hz, 1H), 4.52 (t, J = 5.6 Hz, 1H), 4.39 (m, 1H), 3.14-3.05 (m, 2H), 1.91-1.84 (m, 2H), 1.59 (m, 1H), 1.52-1.46 (m, 2H), 1.36 (s, 9H), 1.25-1.16 (m, 2H), 0.84 (t, J = 4.8 Hz, 3H), 0.72 (d, J = 4.8 Hz, 3H); 13 C NMR (100 MHz, DMSO-d 6 ): 173.0, 163.9, 159.9, 156.6, 153.3, 142.0, 135.2, 78.4, 53.3, 51.2, 37.1, 28.1, 25.3, 24.9, 15.3, 10.7. HRMS (m/z): [MH] + calc. for C 20 H 35 N 6 O + 6, 455.2613; found, 455.2616; t R = 7.6 min (20-100% B in 10 min gradient). Boc-(Cha-Oxazole)-Arg (9). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.55 (s, 1H), 8.11 (d, J = 7.9 Hz, 1H), 7.66 (br s, 1H), 7.53 (d, J = 8.6 Hz, 1H), 4.59 (m, 1H), 4.33 (m, 1H), 3.13-3.04 (m, 2H), 1.85 (m, 1H), 1.69-1.81 (m, 3H), 1.44-1.69 (m, 7H), 1.37 (s, 9H), 1.33-1.06 (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.2, 165.0, 159.9, 156.8, 155.4, 142.1, 135.6, 78.5, 51.6, 46.3, 40.4, 40.0, 33.5, 33.1, 31.6, 28.2, 26.0, 25.9, 25.7, 25.3. HRMS (m/z): [MH] + calc. for C 23 H 39 N 6 O + 6, 495.2926; found, 495.2927; t R = 8.4 min (20-100% B in 10 min gradient).
Boc-(Ala-Oxazole)-Arg (10). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.57 (s, 1H), 8.16 (d, J = 8.2 Hz, 1H), 7.60 (d, J = 8.3 Hz, 1H), 7.53 (t, J = 5.8 Hz, 1H), 4.79 (m, 1H), 4.41 (m, 1H), 3.15-3.05 (m, 2H), 1.87 (m, 1H), 1.77 (m, 1H), 1.55-1.46 (m, 2H), 1.43 (d, J = 7.2 Hz, 3H), 1.38 (s, 9H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.0, 160.0, 156.6, 142.0, 135.3, 51.1, 44.2, 40.3, 28.2, 27.9, 25.3, 18.7. HRMS (m/z):[mh] + calc. for C 17 H 29 N 6 O + 6, 413.2143; found, 413.2143; t R = 7.3 min (20-100% B in 10 min gradient). H-(Leu-Oxazole)-Arg (5). The crude compound 7 (25 mg, 0.06 mmol) was treated with 20% TFA in CH 2 Cl 2 (0.5 ml) to remove the Boc group. The reaction mixture was dried under N 2 and purified by rphplc to yield 5 as a white powder, as the trifluoroacetate salt (20 mg, 90%). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.54 (d, J = 7.8 Hz, 1H), 8.37 (s, 1H), 7.09 (br s, 1H), 3.12-3.05 (m, 2H), 3.12 (q, J = 6.6 Hz, 2H), 1.98-1.90 (m, 2H), 1.82-1.74 (m, 2H), 1.64-1.56 (m, 2H), 1.50 (m, 1H), 0.84 (d, J = 6.6 Hz, 3H), 0.81 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 173.0, 164.2, 160.0, 156.3, 141.9, 135.2, 51.1, 45.1, 41.2, 40.3, 27.7, 25.3, 22.5, 22.3, 21.4. HRMS (m/z): [MH] + calc. for C 15 H 27 N 6 O + 4, 355.2088; found, 355.2088; t R = 7.5 min (0-100% B in 15 min gradient). Ac-(Leu-Oxazole)-Arg (6). Boc-L-Leu-Oxazole methyl ester (7d, 0.17 g, 0.50 mmol) was treated with 20% TFA in CH 2 Cl 2 (3 ml) and stirred at room temperature for 2 h. The reaction mixture was dried under N 2 and the residue in DMF (1.0 ml) was treated with DIPEA (0.4 ml, 2.00 mmol) followed by acetic anhydride (0.10 ml, 1.00 mmol) and stirred at RT for 1 h. The reaction mixture was evaporated and redissolved in EtOAc (2 ml) and washed with sat. NaHCO 3 (2 2 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (~40 mg, ESI-MS: m/z 255.2 [MH] + ) was dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 2 ml) and stirred until the reaction went to completion. The EtOH in the reaction was removed in vacuo and the aqueous solution was acidified with 2 M HCl (1 ml) and extracted with EtOAc (3 2 ml). Combined organic extracts were dried over MgSO 4, filtered and evaporated to dryness. The Ac-(Leu-Oxazole)-carboxylic acid crude product (0.11 g, 0.46 mmol, ESI- MS: m/z 241.1 [MH] + ) was coupled to H-Arg-OEt (0.13 g, 0.46 mmol) followed by ester hydrolysis. The last coupling and hydrolysis steps were the same for compound 7 (in page S8). The crude product was purified by rphplc to yield 6 as a white powder, as the trifluoroacetate salt (50 mg, 25%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.57 (m, 1H), 8.47 (m, 1H), 8.19 (d, J = 8.3 Hz, 1H), 7.47 (m, 1H), 5.03 (m, 1H), 4.38 (m, 1H), 3.12-3.05
(m, 2H), 1.85 (s, 3H), 1.80-1.70 (m, 2H), 1.65 (m, 1H), 1.56 (m, 1H), 1.52-1.45 (m, 2H), 0.90 (d, J = 6.8 Hz, 3H), 0.85 (d, J = 6.8 Hz, 3H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.1, 169.2, 164.4, 160.0, 156.5, 142.0, 135.4, 51.2, 45.0, 41.3, 40.3, 27.8, 25.4, 24.1, 22.6, 22.3, 21.4. HRMS (m/z):[mh] + calc. for C 17 H 29 N 6 O + 5, 397.2194; found, 397.2193; t R = 10.4 min (0-100% B in 20 min gradient). Boc-Leu-NH 2 (11a). A solution of Boc-Leu-OH (12.47 g, 50 mmol) and triethylamine (7.25 ml, 52 mmol) in THF (30 ml) was cooled to -20 C under argon and a solution of ethyl chloroformate (5.25 ml, 55 mmol) in THF added dropwise. The resultant solution was stirred for 20 minutes, and then ammonium hydroxide (28%, 20 ml) was added in one portion. The mixture was then stirred for 3 hours between 0-5 C, and concentrated in vacuo. The solution was acidified (ph = 2) with aqueous KHSO 4 (1 M, ~50 ml) and extracted with ethyl acetate (2 150 ml). The organic extracts were washed with saturated NaHCO 3 solution (100 ml), water (100 ml) and brine (100 ml), then dried over MgSO 4, filtered and concentrated under reduced pressure to give a white powder (11a, 10.48 g, 91%) which was used without further purification. Boc-Leu-thioamide (11b). Crude Boc-Leu-NH 2 (11a) was dissolved in 1,2- dimethoxyethane (110 ml) and Lawesson s reagent (11 g, 27.3 mmol, 0.6 eq.) was added in one portion. The suspension was stirred at room temperature for 16 hours, and the resultant clear solution concentrated in vacuo. Purification by column chromatography (1:1 ethyl acetate:petroleum ether) gave a sticky white solid (11b, 7.97 g, 71%). Boc-Leu-5-methylthiazole ethyl ester (11c). To a solution of the thioamide 11b (958 mg, 3.90 mmol) in absolute ethanol (39 ml) was added pyridine (345 µl, 4.30 mmol) and ethyl 2-chloroacetoacetate (540 µl, 3.9 mmol). The solution was refluxed for 2 hours, and additional pyridine (147 µl) and ethyl 2-chloroacetoacetate (540 µl) added. After 2 hours reflux, the mixture was concentrated in vacuo and purified by column chromatography (SiO 2, 1:2 ethyl acetate:petroleum ether) to give a yellow solid (11c, 1.35 g, 98 %). 1 H NMR (400 MHz, DMSO-d 6 ): δ 4.31 (q, J = 7.2 Hz, 2H), 2.70 (s, 3H), 1.91-1.78 (m, 2H), 1.68 (m, 1H), 1.45 (s, 9H), 1.35 (t, J = 6.8 Hz, 3H), 0.97 (m, 6H). Boc-Leu-5-methylthiazole carboxylic acid (11d). To a solution of the ester 11c (320 mg, 0.90 mmol) in methanol (4.2 ml) at -5 C was added aqueous LiOH (0.5 M, 4.2 ml)
dropwise. The mixture was stirred for 20 minutes, and then 2 hours at room temperature. The solution was acidified to ph 3 with 10 % citric acid solution and then to ph 2 with 5 drops of 2M hydrochloric acid. The solution was then extracted with ethyl acetate (3 x 25 ml) and the combined organic extracts washed with brine (30 ml), dried over MgSO 4, filtered and concentrated under reduced pressure to give a yellow oil. The oil was redissolved in 1:1 acetonitrile:water and lyophilized to give a white powder (11d, 276 mg, 94%). Boc-(Leu-Thiazole)-Arg (11). To a prestirred solution of the acid 11d (404 mg, 1.23 mmol), BOP (808 mg, 1.83 mmol), and DIPEA (635 µl, 3.65 mmol) in DMF (6 ml) was added H-Arg-OEt 2HCl (670 mg, 2.43 mmol). The resultant mixture was stirred overnight, and then concentrated under reduced pressure. The residue was redissolved in 1:1 methanol:water containing LiOH H 2 O (206 mg, 4.92 mmol, 4 eq.) and stirred for 2 hours. The solution was neutralized with dilute HCl, and subjected to purification by HPLC. Following lyophilization, the titled compound 11 was obtained as a white powder, as the trifluoroacetate salt (179 mg, 24%). 1 H NMR (600 MHz, DMSO-d 6 ): δ 8.41 (d, J = 7.7 Hz, 1H), 7.74 (d, J = 8.2 Hz, 1H), 7.54 (t, J = 5.5 Hz, 1H), 4.74 (m, 1H), 4.29 (m, 1H), 3.1 (m, 2H), 1.84 (m, 1H), 1.71 (m, 1H), 1.67 (d, J = 4.5 Hz, 3H), 1.53 (m, 2H), 1.4 (s, 9H), 0.9 (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 175.6, 173.2, 161.6, 156.7, 155.4, 154.3, 125.0, 78.5, 52.3, 51.3, 43.2, 40.3, 28.2, 27.6, 25.5, 24.4, 22.9, 21.3, 17.3. HRMS (m/z): [MH] + calc. for C 21 H 37 N 6 O 5 S +, 485.2541; found, 485.2543. Ethyl 2-amino-3-oxobutanoate hydrochloride (12a). A solution of NaNO 2 (7.0 g, 100 mmol) in H 2 O (15 ml) was added dropwise to a mixture of ethyl acetoacetate (10 ml, 77 mmol) in glacial AcOH (15 ml) at room temperature. The reaction mixture was stirred for 1 h, then H 2 O (55 ml) was added and stirred for 2 h. The reaction mixture was then extracted with Et 2 O (3 80 ml). The combined organic extracts were washed with H 2 O (1 100 ml), sat. NaHCO 3 (1 100 ml) and brine (1 100 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo to give 12.0 g of yellow oil. This was dissolved in EtOH (130 ml) and to this solution, acetyl chloride (7.5 ml) was added dropwise to this solution. After addition, it was diluted with EtOH (75 ml) and then 10% Pd/C (200 mg) was added. The mixture was hydrogenated at 15 psi on a Parr hydrogenator for 3 h. The reaction mixture was filtered through celite and the filtrate was
concentrated in vacuo to give 11.5 g of product (12a, ESI-MS: m/z 146.1 [MH] + ) as a yellow syrup. The crude product was used for the next step without purification. Synthesis of 12b. Cbz-protected L-leucine amino acid (6.0 g, 22.5 mmol) in DMF (50 ml) was first activated with HBTU (8.5 g, 22.5 mmol) and DIPEA (4.0 ml, 22.5 mmol) for 15 min. After that, the ethyl 2-amino-3-oxobutanoate hydrochloride (12a, 3.4 g, 18.7 mmol) was added and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated in vacuo and the residue was dissolved in EtOAc (70 ml) and washed with sat. NaHCO 3 (3 100 ml). The combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude was purified by flash column chromatography (SiO 2, 30% EtOAc in petroleum ether, R f product 0.2) to give product as a yellow syrup (12b, 3.0 g, 34%, 70% pure, ESI-MS: m/z 393.2 [MH] +, t R = 9.5 min, 20-100% B in 10 min gradient). Cbz-Leu-5-methylimidazole ethyl ester (12c). The product (12b, 3.01 g, 7.61 mmol) was treated with NH 4 OAc (5.8 g, 19.0 mmol) in glacial AcOH (25 ml) and microwave heated at 150 C for 30 min. After 30 min, the reaction mixture was diluted with EtOAc (88 ml) and washed with a mixture of H 2 O/28% aq. NH 3 solution (4:1, 80 ml) and brine (1 80 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 50% EtOAc in petroleum ether, R f product 0.4) to give 1.4 g of 12c (51%). 1 H NMR (600 MHz, CDCl 3 ), δ 8.50 (t, J = 8.3 Hz, 1H), 7.30-7.24 (m, 5H), 5.16-5.12 (m, 2H), 5.05 (m, 1H), 4.38-4.30 (m, 2H), 2.56 (s, 3H), 1.99 (m, 1H), 1.68 (m, 1H), 1.54 (m, 1H), 1.37-1.34 (m, 3H), 0.88 0.87 (m, 3H), 0.82-0.80 (m, 3H); ESI-MS: m/z 374.1 [MH] + ; t R = 8.0 min (20-100% B in 10 min gradient). Boc-Leu-5-methylimidazole ethyl ester (12d). The product from above (12c, 1.40 g, 3.70 mmol) was dissolved in MeOH (60 ml), treated with 10% Pd/C (50 mg) and hydrogenated at 40 psi on a Parr hydrogenator for 5 h. The mixture was filtered through celite and the filtrate was concentrated in vacuo. The crude product was then dissolved in CH 2 Cl 2 (15 ml) and treated with di-tert-butyldicarbonate (0.80 g, 3.70 mmol), stirred at RT for 30 min. After 30 min, the reaction mixture was evaporated to dryness. The crude
product (12d, 1.40 g, ESI-MS: m/z 340.2 [MH] + ) was used for the next step without additional purification. N-Methylation of compound 12d. Boc-Leu-5-methylimidazole ethyl ester (12d, 0.40 g, 1.10 mmol) in DMF (5 ml) was treated with NaH (53 mg, 2.20 mmol) and MeI (0.14 ml, 2.20 mmol) and stirred at RT for 2 h. H 2 O (10 ml) and EtOAc (10 ml) was added to the reaction mixture and the two layers were separated. The organic phase was collected, dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 30% EtOAc in petroleum ether, R f for 12e = 0.14, 12f = 0.40) to give 0.4 g of products (70%, 12e, 12f, ratio 1.5:1). Compound 12e. 1 H NMR (600 MHz, CDCl 3 ), δ 5.26 (m, 1H), 4.92 (m, 1H), 4.33 (q, J = 7.2 Hz, 2H), 3.90 (s, 3H), 2.45 (s, 3H), 1.78 (m, 1H), 1.70-1.60 (m, 2H), 1.42 (s, 9H), 1.38 (t, J = 7.2 Hz, 1H), 0.97 (d, J = 6.6 Hz, 3H), 0.94 (d, J = 6.6 Hz, 3H); ESI-MS: m/z 354.2 [MH] + Compound 12f. 1 H NMR (600 MHz, CDCl 3 ), δ 5.17 (d, J = 9.6 Hz, 1H), 4.92 (m, 1H), 4.40 (q, J = 7.2 Hz, 2H), 3.59 (s, 3H), 2.53 (s, 3H), 1.90 (m, 1H), 1.73 (m, 1H), 1.66 (m, 1H), 1.43 (s, 9H), 1.39 (t, J = 7.2 Hz, 1H), 0.98 (d, J = 6.6 Hz, 3H), 0.95 (d, J = 6.6 Hz, 3H); ESI-MS: m/z 354.2 [MH] + Ester hydrolysis of 12d-f. The imidazole compounds 12d-f (0.10 g, ~0.30 mmol) were dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 3 ml) and heated in microwave at 120 C for 10 min (hydrolysis required heating). The EtOH in the reaction was concentrated in vacuo and the aqueous solution was acidified with 2 M HCl (2 ml) and extracted with EtOAc (3 3 ml). Combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude product was used for next step without further purification. 12d (ESI-MS: m/z 312.2 [MH] + ); 12e and 12f (ESI-MS: m/z 326.2 [MH] + ). Synthesis of final imidazole compounds 12 14. Intermediates 12d-f (~0.10 g, ~0.3 mmol) were coupled to H-Arg-OEt and then treated with aqueous base to hydrolyze the ester by following previously described procedures for compound 7 in page S8. The crude compounds 12 14 were purified by rphplc.
Boc-(Leu-Imidazole)-Arg (12, 35 mg, 25%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.00 (br s, 1H), 7.65 (m, 1H), 7.29 (br s, 1H), 4.67 (m, 1H), 4.39 (m, 1H), 3.15-3.06 (m, 2H), 2.41 (s, 3H), 1.84 (m, 1H), 1.74-1.66 (m, 2H), 1.61-1.47 (m, 4H), 1.36 (s, 9H), 0.90 0.86 (2 sets of d, J = 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.3, 173.2, 158.6, 158.4, 156.7, 155.2, 147.8, 78.6, 51.2, 46.5, 40.4, 28.4, 28.1, 25.2, 24.2, 22.7, 21.5, 10.5. HRMS (m/z): [MH] + calc. for C 21 H 38 N 7 O + 5, 468.2929; found, 468.2929; t R = 12.2 min (0-100% B in 20 min gradient). Boc-(Leu-NMe(Y)Imidazole)-Arg (13, 30 mg, 21%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 7.67 (m, 1H), 7.59 (m, 1H), 7.28 (t, J = 8.2 Hz, 1H), 4.75 (m, 1H), 4.42 (m, 1H), 3.50 (s, 3H), 3.15-3.06 (m, 2H), 2.43 (s, 1H), 1.88-1.76 (m, 2H), 1.70 (m, 1H), 1.62-1.55 (m, 2H), 1.50-1.43 (m, 2H), 1.36 (s, 9H), 0.94-0.85 (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.4, 162.6, 158.5, 156.7, 155.4, 147.3, 132.9, 78.1, 50.7, 44.9, 41.5, 40.3, 30.0, 28.9, 28.2, 25.2, 24.2, 23.1, 21.6, 9.3. HRMS (m/z): [MH] + calc. for C 22 H 40 N 7 O + 5, 482.3085; found, 482.3086; t R = 10.1 min (0-100% B in 15 min gradient). Boc-(Leu-NMe(X)Imidazole)-Arg (14, 32 mg, 22%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.93 (m, 1H), 7.86 (m, 1H), 7.75 (m, 1H), 4.87 (m, 1H), 4.36 (m, 1H), 3.77 (s, 3H), 3.18-3.10 (m, 2H), 2.36 (d, J = 4.0 Hz, 3H), 1.91-1.83 (m, 2H), 1.72 (m, 1H), 1.64-1.56 (m, 4H), 1.37 (s, 9H), 0.94-0.88 (2 sets of d, J = 6.0 Hz, 6H); 13 C NMR (150 MHz, DMSOd 6 ): 172.7, 158.8, 158.5, 157.1, 155.4, 148.2, 124.7, 79.2, 52.2, 44.5, 40.3, 32.8, 28.0, 27.6, 25.4, 24.2, 22.7, 21.4, 10.6. HRMS (m/z): [MH] + calc. for C 22 H 40 N 7 O + 5, 482.3085; found, 482.3084; t R = 11.7 min (0-100% B in 20 min gradient). Synthesis of compound 15b. Boc-Leu-OMe (15a, 2.01 g, 8.20 mmol) in EtOH (15 ml) was treated with hydrazine hydrate solution (1.6 ml, 32.0 mmol) and the reaction mixture was stirred at RT overnight. After overnight, the reaction mixture was concentrated in vacuo to give 15b as a white solid (1.50 g, ESI-MS: m/z 246.2 [MH] + ). It was used for next step without additional purification. Synthesis of compound 15c. The starting material 15b (0.60 g, 2.50 mmol) in anhydrous CH 2 Cl 2 (2 ml) was stirred at 0 C under N 2. To this cooled solution, Et 3 N (1.0 ml, 7.50
mmol) was added followed by dropwise addition of ethyl chlorooxoacetate (0.3 ml, 3.00 mmol). The reaction mixture was stirred at RT overnight. The reaction mixture was diluted with EtOAc (5 ml), the salt was filtered and the filtrate was concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 60% EtOAc in petroleum ether, R f product 0.4) to give 0.60 g of product (15c, 65%) as an offwhite solid. 1 H NMR (600 MHz, CDCl 3 ), δ 9.37 (br s, 1H), 5.01 (br d, J = 6.0 Hz, 1H), 4.41 (q, J = 7.2 Hz, 2H), 4.29 (br s, 1H), 1.59 (m, 1H), 1.48 (s, 9H), 1.42 (t, J = 7.2 Hz, 3H), 0.96-1.00 (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z 345.2 [MH] + Boc-Leu-1,3,4-Oxadiazole ethyl ester (15d). To compound 15c (0.60 g, 1.60 mmol) in anhydrous CH 2 Cl 2 (5 ml) under N 2 was added Et 3 N (0.3 ml, 2.10 mmol) followed by 4- toluenesulfonyl chloride (0.40 g in 5 ml CH 2 Cl 2, 2.00 mmol). The reaction mixture was stirred at RT overnight. The reaction mixture was diluted with CH 2 Cl 2 (10 ml) and washed with H 2 O (1 10 ml). The organic phase was collected, dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 20% EtOAc in petroleum ether, R f product 0.2) to give 0.50 g of product (15d, 96%) as a pale yellow syrup. 1 H NMR (600 MHz, CDCl 3 ), δ 5.18 (br m, 1H), 5.04 (br m, 1H), 4.55 (q, J = 7.2 Hz, 2H), 1.83-1.72 (m, 3H), 1.50-1.47 (m, 12H), 1.02-1.00 (2 sets of d, J = 2.4 Hz, 6H); ESI-MS: m/z 328.2 [MH] + Synthesis of Boc-(Leu-1,3,4-Oxadiazole)-Arg (15). Boc-Leu-1,3,4-Oxadiazole ethyl ester (15d, 0.25 g, 0.77 mmol) in MeOH (2 ml) was treated with DIPEA (0.3 ml, 1.54 mmol) and H-Arg-OEt (0.21, 0.77 mmol). The reaction mixture was heated in microwave at 100 C for 1 h. The reaction was cooled down to RT and treated with 1 M NaOH solution (2 ml) and stirred for 15 min. The MeOH solution was concentrated in vacuo and the residue was redissolved in ACN/H 2 O for rphplc purification. (30 mg, 9%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 9.51 (d, J = 7.3 Hz, 1H), 7.70 (d, J = 8.3 Hz, 1H), 7.64 (t, J = 5.5 Hz, 1H), 4.86 (m, 1H), 4.37 (m, 1H), 3.14-3.08 (m, 2H), 1.89 (m, 1H), 1.83-1.77 (m, 2H), 1.72-1.61 (m, 2H), 1.59-1.50 (m, 2H), 1.38 (s, 9H), 0.93-0.88 (2 sets of d, J = 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 172.2, 168.9, 158.3, 156.7, 155.2, 153.4, 78.7, 52.2, 45.2, 40.5, 40.3, 28.1, 27.2, 25.4, 24.1, 22.6, 21.4. HRMS (m/z): [MH] + calc. for C 19 H 34 N 7 O + 6, 456.2565; found, 456.2566; t R = 11.5 min (0-100% B in 15 min).