Fusarium strain identification in complex feeds from Romanian market

Volume 16(1), 207-211, 2012 JOURNAL of Horticulture, Forestry and Biotechnology www.journal-hfb.usab-tm.ro Fusarium strain identification in complex feeds from Romanian market Ioja-Boldura Oana Maria 1, Popescu Sorina 1 1 Banat University of Agricultural Sciences and Veterinary Medicine Timisoara *Corresponding author. Email:biotehnologii_usab@yahoo.com Abstract Fusarium contamination is a major agricultural problem as quality and yield can be reduced, but more importantly many species in the genus produce mycotoxins responsible for serious diseases in humans and farm animals. The most common mycotoxine in cereals is deoxynivalenol (DON) produced by certain isolates of Fusarium spp., being prevalent worldwide in crops used for food and feed production. Identification of Fusarium species is critical to predict the potential mycotoxigenic risk of the cereals, therefore the development of an accurate and complementary method which permits a rapid, sensitive and reliable specific diagnosis of Fusarium species, is necessary. DNA based approaches applied in this study have been already reported as rapid, sensitive and specific alternatives to identify the main trichothecene-producing Fusarium species. The biological material consisted of eight samples of commercial feeds were all positive for Fusarium species and therefore being suitable for further identification of those pathogenic organisms. In addition two of toxins biosynthetic genes were also detected. Therefore, this method proved to be suitable in screening of forage samples, in order to detect their contamination. Key words Fusarium ssp., mycotoxines, feed products, screening, PCR In the target region West of Romania and South-East of Hungary, as well as worldwide, Fusarium head blight (FHB), also known as scab, is a devastating disease of small grains causing serious yield losses and low grain quality. The losses in regular years are of 1-3%, and in some years the losses are higher, reaching 65-80% (Jurado et al, 2004). The disease commonly occurs in wheat, barley, rye and less in oats. The main causal agents of FHB in Europe are Fusarium graminearum and Fusarium culmorum, but Fusarium proliferatum or Fusarium verticiliodes could be also present. Although FHB may cause wheat yield losses, the interest in FHB is primarily fuelled by the ability of Fusarium species to produce mycotoxins. FHB pathogens produce a diversified spectrum of mycotoxins depending on the species (Bennett and Klich, 2003). Trichothecenes, zearalenon, moniliformin and fumonisins are the most important mycotoxins produced by Fusarium fungi. Among the trichothecenes, deoxynivalenol (DON) is the predominant mycotoxin throughout Europe and is mainly produced by Fusarium graminearum. These secondary fungal metabolites can accumulate to significant doses and as such cause a serious impediment for human and animal health. The fungi persist and multiply on infected crop residues of small grains and corn. During moist weather, spores of the fungi are windblown or splashed onto the heads of cereal crops. Spores may originate from the same crop or can be blown from surrounding crops sometimes long distances away. Conventional characterization of toxigenic Fusarium species has been based mainly on morphological and cross-fertility criteria (Leslie et al. 2001), which are the most routinely performed all over the world. Nevertheless, recognition by morphological characters sometimes is not enough for accurate identification of fungal isolates at the species level. Furthermore, both morphological and mating type characterization are time consuming and require considerable expertise in Fusarium taxonomy and physiology (Leslie et al, 2007). As identification of Fusarium species is critical to predict the potential mycotoxigenic risk of the isolates, there is a need for accurate and complementary tools which permit a rapid, sensitive and reliable specific diagnosis of Fusarium species. In this work DNA based approaches have been applied because they are rapid, sensitive and specific alternatives to identify the main fumonisin and trichothecene-producing Fusarium species. Material and Methods Biological material: 8 samples of commercial feeds (labeled A, B, C, D, E, F, G, H) were subjected to screening for pathogenic fungal species and two of theirs toxicogenic biosynthetic genes. 207

Working methods DNA extraction 100 mg ground material was mixed with 300 μl sterile distillated water. 700 μl CTAB buffer (CTAB -20g/l; NaCl- 1,4 M; Tris-HCl - 0,1 M; Na 2 EDTA- 20 mm, ph 8) was added together with 20 μl RNase solution (10 mg/ml) and the mixture was incubated at 65 C for 30 min. The samples were centrifuged at 12,000 g for 10 min and the supernatant was transferred to a tube with 500 μl chloroform, vortexed and centrifuged at 12,000 g for 15 min. The upper layer was transferred to a new tube and 2 volumes of CTAB precipitation solution (CTAB 5g/l; NaCl 0,04M) were added. The samples were incubated at room temperature for 60 min and centrifuged at 12,000 g for 5 min. The pellet was dissolved in 350 μl NaCl 1.2M and 350 μl cloroform was added, The samples were mixed by vortex and centrifuged at 12,000 g for 10 min. The upper layer was precipitated with 0.6 volumes of isopropanol, incubated at room temperature for 20 min and centrifuged at 12,000 g for 10 min. The pellet was washed in 70% ethanol, vacuum dried and re-suspended in 100 μl sterile ultrapure water. PCR amplification The primers used for strain (Table 1) and toxicogene genes identification (Table 1) had specific sequences (Chandler et al., 2003; Lopez-Errasquin et al., 2007). The primers sequences used for strain identification Table 1 Specie Primers sequence Amplicon size (bp) Fusarium graminearum Fgr-F/Fgr-R Fusarium culmorum Fc-R/Fc-F Fusarium proliferatum Fp3-F/Fp4-R Fusarium verticillioides Fps-F/ Vert2 Tri 7 DON Tri7-F/Tri7DON Tri 13 DON Tri13-F/Tri13DON-R 5 -CTCCGGATATGTTGCGTCAA-3 5 -GGTAGGTATCCGACATGGCAA-3 5 -ATGGTGAACTCGTCGTGGC-3 5 -CCCTTCTTACGCCAATCTCG-3 5 CGGCCACCAGAGGATGTG 3 3 CAACACGAATCGCTTCCTGAC 5 5 CGCACGTATAGATGGACAAG 3 3 CACCCGCAGAATCCATCCATCAG 5 5 TGCGTGGCAATATCTTCTTCCTA 3 3 GTGCTAATATTGTGCTAATATTGTGC 5 5 CATCATGAGACTTGTGTCAGAGTTTGGG3 3 GCTAGATCGATTGTTGCATTGAG 5 450 570 230 700 381-445 282 PCR reagents were as follows: Go Taq Green Master Mix PCR kit from Promega 2X 12.5 µl, 20 pmol of each primer, DNA template, adjusted with distillate water to 25µl. The amplification conditions followed the literature data (Sampietro et al., 2010). Amplification reactions were performed in a Corbett RESEARCH Thermal Cycler, following the indications from literature. Amplicons were analyzed by electrophoresis on 2% agarose gel (Promega, USA) and visualized in Ethidium Bromide (0.4 ng/ml) presence. Results and Discussions The first amplification was carried out for initial screening of samples with the primers that were developed for the identification of all Fusarium species (Fig. 1). 208

Fig. 1: Results of the initial screening for Fusarium spp. presence of samples: lane 1, feed sample A; lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G; lane 8; feed sample H ;lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker, Promega The presence of the 750 bp amplicon indicates the presence of Fusarium infected material. As the pathogen was detected in al the samples the following PCR reaction were carried out in order to identify the Fusarium species that are present. The first reaction was performed for identification of Fusarium verticilloides contaminated samples. The specific PCR product is estimated to have 700 bp. Based on molecular weight of the amplicons this specie is present in all analyzed samples. However, some nonspecific products are also visible indicating that other strains of fungi my be present in the biological material (Fig. 2). 1 2 3 4 5 6 7 8 9 10 11 Fig. 2: Results of the F. verticilloides screening of samples: lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G; lane 8, feed sample H ;lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,promega The next PCR reaction was carried out in order to identify Fusarium graminearum contaminated samples. The presence of the specific PCR product, according to the predicted molecular weight (500 bp), can be noticed in all analyzed samples. There are some differences in the intensity of bans, indicating that the pathogen amount differs highly among samples (Fig. 3). 209

Fusarium graminearum Fig. 3 : Results of the F. graminearum screening of samples: lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G; lane 8, feed sample H ;lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker, Promega The screening was continued for the presence of Fusarium proliferatum. Pathogen is emphasized by the presence of a 230 bp PCR product. Like in the previous analyzes this fungi was detected in all analyzed samples (Fig. 4). 1 2 3 4 5 6 7 8 9 10 Fig. 4: Results of the F. proliferatum screening of samples: lane 1, molecular weight marker: PCR marker, Promega; lane 2, feed sample A lane 3, feed sample B; lane 4, feed sample C; lane 5, feed sample D; lane 6, feed sample E; lane 7, feed sample F; lane 8, feed sample G; lane 9, feed sample H; lane 10, control reagent; Next, the samples were subjected to screening for the detection of two genes known as DON toxins biosynthetic (Fig. 5). 1 2 3 4 5 6 7 8 9 10 11 Tri 13 DON biosynthetic gene Fig. 5: Results of the Tri 13 DON biosynthetic gene screening of samples lane 1, feed sample A; lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G; lane 8, feed sample H ;lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker, Promega 210

Tri 7 DON biosynthetic gene Fig. 6: Results of the Tri 7 DON biosynthetic gene screening of samples lane 1, feed sample A ; lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ; lane 8, feed sample H; lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker, Promega The samples proved to be positive for both DON biosynthetic genes, as the presence of a 280 bp amplicon for Tri 13 DON and approximately 400 bp for Tri 7 DON was properly detected. Conclusions 1.PCR based methods can be successfully applied in the screening to identify the contamination with pathogenic fungi, having the advantage of being rapid and cheap. 2.All collected samples were positive for Fusarium species and therefore being suitable for further identification of those pathogenic organisms. 3.The samples were positive for all three tested Fusarium species. 4.In addition two of toxins biosynthetic genes were also detected. 5.This method proved to be suitable in screening of forage samples, in order to detect their contamination. Acknowledgement This work was published during the project Szeged Timisoara axis for the safe food and feed SZETISA1, HURO/0901/147/2.2.2., financed by the Hungary- Romania Cross-Border Co-operation Programme 2007-2013, co-financed by the EU ERDF. References 1.Bennett, J.W., & Klich, M., 2003, Mycotoxins. Clinical Microbiology Reviews, vol.16, pp. 497-512 2.Brown DW, McCormick SP, Alexander NJ, Proctor RH,Desjardins AE, 2002, Inactivation of a cytochrome P-450 is a determinant of trichothecene diversity in Fusarium species.fungal Genetics and Biology 36: 224 233. 3.Chandler EA, Simpson DR, Thomsett MA, Nicholson P, 2003. Development of PCR assays to Tri7 and Tri13 and characterization of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiological and Molecular Plant Pathology 62: 355 367. 4.Jurado M, Vazquez C, Lopez-Errasquin E, Patino B, Gonzalez-Jaen MT, 2004. Analysis of the occurrence of Fusarium species in Spanish cereals by PCR assays. In: Proceedings of the 2nd International Symposium on Fusarium Head Blight and 8th European Fusarium Seminar, vol. 2: 460 464. 5.Leslie J.F., Anderson LL, Bowden RL, Lee LW, 2007, Inter- and intraspecific genetic variation in Fusarium. International Journal of Food Microbiology 119: 25 32. 6.Leslie JF, Zeller KA, Summerell BA, 2001, Icebergs and species in populations of Fusarium. Physiological and Molecular Plant Pathology59: 107 117. 7.Lopez-Errasquin E, Vazquez C, Jimenez M, Gonzalez-Jaen MT, 2007, Real-time RT-PCR assay to quantify the expression of fum1 and fum19 genes from the fumonisin-producing Fusarium verticillioides. Journal of Microbiological Methods 68: 312 317. 8.Sampietro D. A., Marin P., Iglesias J., Presselo D. A., Vattuone M. A. Catalan C. A. N., Gonzalez Jaen M. T., 2010, A molecular based strategy for rapid diagnosis of toxigenic Fusarium species associated to cereal grains from Argentina, Fungal biology, 114, 74-81. 211