A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific (2) CNS-liver Specific () Brain-liver Shared (38) Specific (0) Liver (total 44) Tissue-specific (3) B-L-H shared (37) specific () CNS (conserved 87) Tissue-specific (8) Spinal Cord (total 93) Tissue-specific (0) CNS-liver Specific () Ubiquitous (36) SC-L-H shared(37) Specific () Spinal cord-liver Specific (0) Heart-liver shared (40) Specific (2) Liver (total 44) Tissue-specific (3) CNS (conserved 87) Tissue-specific (8) Spinal Cord (total 93) Tissue-specific (0) CNS-heart shared(68) Specific () Ubiquitous (36) SC-L-H shared(37) Specific () Spinal cord-heart shared (74) Specific () Heart-liver shared (40) Specific (2) Heart (total 4) Tissue-specific () Figure S. Ubiquitous and tissue-associated mirnas and their overlaps among different mouse organs. A. Highlighted numbers of mirnas shared by brain and heart, and spinal cord and liver; B. Highlighted numbers of mirnas shared by brain and liver, and spinal cord and heart. B-L-H indicates brain-liver-heart; SC-L-H indicates spinal cord-liverheart.
A. Probe # Probe name Probe sequences RNAs to be detected MAC2P ATGGACCCGTCTACAGAGGCA 2 MAC2P-2M-2 ctggacccgtctacagaggcc 3 MAC2P-2M- ctggacccgtctacagaggg UGCCUCUGUAGACGGGUCCAU 4 MAC2P-2M-9 ctggacccgtctacagagc MAC2P-2M-8 ctggacccgtctacagac 6 MAC2P-2M-7 ctggacccgtctacagu 7 MAC3P ATCCGGGGCTGCCGGCTTCGA 8 MAC3P-2M-2 ctccggggctgccggcttcgc 9 MAC3P-2M- ctccggggctgccggcttcc UCGAAGCCGGCAGCCCCGGAU 0 MAC3P-2M-9 ctccggggctgccggcttg MAC3P-2M-8 ctccggggctgccggcta 2 MAC3P-2M-7 ctccggggctgccggca 3 MAC4P AGCTAGTCCTGGAACCCGGCA 4 MAC4P-2M-2 cgctagtcctggaacccggcc MAC4P-2M- cgctagtcctggaacccggg UGCCGGGUUCCAGGACUAGCU 6 MAC4P-2M-9 cgctagtcctggaacccgc 7 MAC4P-2M-8 cgctagtcctggaacccc 8 MAC4P-2M-7 cgctagtcctggaaccg 9 MACP ATCTCCCCAAGAAAGCCGGCA MACP-2M-2 ctctccccaagaaagccggcc 2 MACP-2M- ctctccccaagaaagccggg UGCCGGCUUUCUUGGGGAGAU 22 MACP-2M-9 ctctccccaagaaagccgc 23 MACP-2M-8 ctctccccaagaaagccc 24 MACP-2M-7 CTCTCCCCAAGAAAGCg B. Probe: (0. pmoles) 7 7 2 2 8 8 3 3 9 9 4 4 6 6 MAC2P 0 0 2 MAC3P 2 3 3 4 4 6 6 7 7 8 8 MAC4P 9 9 2 2 22 22 23 23 24 24 MACP sirna: MAC2 MAC3 MAC4 MAC (fmoles) 40 0 Figure S2. Titration of hybridization specificity of probes with variable lengths and a mismatch at their and 3 ends. (A). The sequences of synthetic RNA oligos (MAC2, MAC3, MAC4, and MAC) and their probes (MAC2P, MAC3P, MAC4P, and MACP) with different lengths and mismatches (in red). (B). The hybridization specificity by an array analysis. A mixture of different amount (-40 fmoles) of synthetic RNA oligos (MAC2-) were radiolabeled at their end and hybridized to the membrane that were spotted with 0. pmol DNA probes listed in (A). The array results show clear hybridization signals with probes of 8 or more consecutive identical nucleotides. Spotted Membrane Arrayed Results
37 C 0 42 C 0 28 28 29 60 29 60 6 92 6 92 93 93 2 6 2 6 7 7 3 3 46 46 47 47 48 2 48 2 3 3 4 MAC- 4 MAC- 0 C 0 28 29 60 6 92 93 2 6 7 3 46 47 48 2 3 4 MAC- Figure S3. Effect of hybridization temperature on mirna array analysis. small RNAs isolated from mouse brain (00 µg total RNA) were treated for the array as described in the Methods. The radiolabeled small RNAs were divided into three aliquots and hybridized with the mirna membrane array in three different temperatures, 37 C, 42 C and 0 C. No significant difference was detected between 37 C and 42 C. However, mirnas signal was dramatically decreased at 0 C.
input AP AP+PNK 00 0 0 input AP AP+PNK Figure S4. Efficiency of dephosphorylation and pohosphorylation of small RNAs. - P-radiolabeled RNA oligo (MAC) was divided in three aliquots: one as input control, one treated with AP, and one treated with AP, and then with γ- P-ATP and PNK. The results show that the end phosphates were completely removed by AP and re-phosphorylated with γ- P- ATP and PNK to about 92% of the input level.
mir-690 mir-709 mir-7 Pre-miRNA Mature mirna Longer exposure 2 3 2 3 2 3 Mature mirna Figure S. Analysis of mir-690, mir-709, mir-7 and their precursors by Northern blot. Total RNA ( µg) from the mouse spleen, testis and lung were hybridized with probes complementary to the indicated mirnas. The precursors for mir-690 (A), mir-709 (B) and mir-7 (C) were highly abundant in all tissues. Mature mir-690, mir-709 and mir-7 were also detectable after longer exposure. The number,, 2, and 3, represents samples from spleen, testis and lung, respectively.