REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP1-FOXO1 INTERACTION

Similar documents
Supplementary Materials

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

Supplementary Figure 1 a

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

Supplementary Document

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Appendix

Supplementary Figures

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

SUPPLEMENTARY INFORMATION

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

RayBio KinaseSTAR TM Akt Activity Assay Kit

SUPPLEMENTARY INFORMATION

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

Supplementary Figure 1

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Nature Immunology: doi: /ni.3836

Protocol for Gene Transfection & Western Blotting

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

The Schedule and the Manual of Basic Techniques for Cell Culture

Supplementary Information

Supplementary Information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

BIOLOGY 621 Identification of the Snorks

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Western Immunoblotting Preparation of Samples:

SUPPORTING INFORMATION


Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Supplementary Materials and Methods

SUPPLEMENTARY RESULTS

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Supporting Information

SUPPLEMENTARY MATERIAL

Supplementary Figure S1

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

Supplementary Figure 1

Protocol for purification of recombinant protein from 300 ml yeast culture

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Supplementary Figure 1a

supplementary information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Figure 1

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Trident Membrane Protein Extraction Kit

PATIENTS AND METHODS. Subjects

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies

Supplemental Figures: Supplemental Figure 1

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis

Nuclear Extraction Kit

Transcription:

REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP-FOXO INTERACTION Yingjiang Zhou, Justin Lee, Candace M. Reno, Cheng Sun, Sang Won Park, Jason Chung, Jaemin Lee, Simon J. Fisher, Morris F. White, Sudha B. Biddinger, Umut Ozcan Nature Medicine doi:.38/nm.93

Supplementary Figures a DBD XBPs AD FoxO Luciferase b DBD FoxO AD XBPs Luciferase pm-xbps pvp6-foxo pg5-luc pm-foxo pvp6-xbps pg5-luc Cotransfection Cotransfection XBPs DBD AD FoxO TATA Box Luciferase FoxO DBD AD XBPs TATA Box Luciferase c + + + + BEZ35 Insulin pakt Ser473 pakt Thr38 Akt Supplementary Figure. XBPs interacts with FoxO in mammalian two-hybrid system. (a b Schematic diagram for mammalian two-hybrid system. (a XBPs cdna was cloned into pm vector to generate a fusion protein consisting of XBPs and GAL4-DBD. FoxO cdna was cloned into pvp6 vector to generate a fusion protein consisting of FoxO and VP6-AD. The three constructs, pm-xbps, pvp6-foxo and pg5-luc, were cotransfected into CHO cells to measure the interaction between XBPs and FoxO. (b FoxO cdna was fused to the GAL4-DBD in the pm vector and XBPs cdna was fused to the VP6-AD in the pvp6 vector. The two constructs were cotransfected into CHO cells together with pg5-luc to confirm the interaction between FoxO and XBP. (c BEZ35 inhibits insulin-stimulated Akt phosphorylation on both Thr38 and Ser473. Zhou, et al. Supplementary Figure Nature Medicine doi:.38/nm.93

a d Plasma insulin (ng ml 8 6 4 Day 9 e XBPs Tubulin 35 3 5 5 b Relative mrna level.5.5 Dnajb9 Pdia3 Hspa5 5 5 3 6 9 Time after glucose injection (min f Blood glucose (%Basal 8 6 4 c 4 3 Day 3 Fed Day 5 6-h fasted 5 3 6 9 Time after insulin injection(min g Ins IP:IR IP:IRS + + + + + + PY IR PY IRS h Nuclear pakt Ser473 Akt Lysate FoxO/tubulin.4..8.6.4. FoxO/lamin A/C..8.6.4. FoxO Tubulin FoxO Lamin A/C i Foxo/Rn8s..8.6.4. Supplementary Figure. Low level of XBPs expression in the liver of ob/ob mice improves glucose homeostasis without enhancing the insulin receptor signaling. Nine week-old, male, 7 ob/ob mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 ( PFU g through tail vein. (a XBPs protein levels in the liver on post-injection day 9. (b mrna levels of ER chaperon genes in the liver. (c Blood glucose levels in fed and fasted states. (d Plasma insulin levels. (e Glucose tolerance test on day 5 and (f insulin tolerance test on day 7 after the injection. (g In vivo insulin receptor signaling, (h total and nuclear FoxO levels, and (i mrna levels of Foxo in the liver of Ad-LacZ or Ad-XBPs injected ob/ob mice. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <.. Zhou, et al. Suplementary Figure Nature Medicine doi:.38/nm.93

a 3 5 5 5 5 3 6 9 Time after pyruvate injection (min b Glycogen Content (mg g 35 3 5 5 5 c pir.4..8.6.4. pir/ir.5.5.5 pirs/irs..8.6.4. pirs/irs..8.6.4. pakt/akt 4.5 4 3.5 3.5.5.5 Supplementary Figure 3. High-level expression of XBPs in the liver increase insulin receptor signaling. (a, b Seven-week-old, male, ob/ob mice were injected with Ad-LacZ (n = 6 or 7 Ad-XBPs (n = 6 (4 PFU g through tail vein. (a Pyruvate tolerance test was performed on day 4 after injection. (b Liver glycogen content in adenovirus-injected mice. (c Seven-weekold, male, ob/ob mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (.8 PFU g 8 through tail vein. On day 6 after injection, in vivo insulin receptor signaling was analyzed in the liver of adenovirus-injected ob/ob mice. The ratios of phospho-ir, phospho-ir/total IR, phospho- Ser473 IRS/total IRS, phospho-irs/total IRS, and phospho-akt /total Akt were analyzed. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <., P <.. Zhou, et al. Supplementary Figure 3 Nature Medicine doi:.38/nm.93

Plasma insulin (ng ml 8 7 6 5 4 3 5 3 6 9 Time after glucose injection (min Supplementary Figure 4. Glucose-stimulated insulin secretion during glucose tolerance test in ob/ob mice expressing medium dose of XBPs. Seven-week-old, male, ob/ob mice were injected 7 with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (4 PFU g through tail vein. GSIS was performed on day 6 after virus injection. Zhou, et al. Suplementary Figure 4 Nature Medicine doi:.38/nm.93

a 6 5 4 3 Pre-Infection b Initial (% 8 6 LIRKO 4 5 3 6 9 Time after insulin injection (min c mrna level 4 3 Dnajb9 Pdia3 Hspa5 d IRS/-DKO e 6 5 Initial (% 8 6 4 5 3 6 9 Time after insulin injection (min mrna level 4 3 Dnajb9 Pdia3 Hspa5 Supplementary Figure 5. XBPs improves glucose homeostasis independent of insulin receptor signaling. (a Hyperglycemia induced by STZ treatment. (b Insulin tolerance test in Ad-LacZ or Ad-XBPs injected LIRKO mice (n = 7 in each group on day 6 post-infection. (c mrna levels of Dnajb9, Pdia3 and Hspa5 in the liver of Ad-LacZ or Ad-XBPs injected LIRKO mice. (d Insulin tolerance test in Ad-LacZ or Ad-XBPs injected IRS/ DKO mice (n = 8 in each group on day 6 post-infection. (e mrna levels of Dnajb9, Pdia3 and Hspa5 in the liver of Ad-LacZ or Ad-XBPs injected IRS/ DKO mice. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <., P <.. Zhou, et al. Supplementary Figure 5 Nature Medicine doi:.38/nm.93

a 5 5 Day 3 b 4 35 3 5 5 5 5 3 6 Time after glucose injection (min c Blood glucose (%Basal 8 6 4 5 3 6 9 Time after insulin injection (min d 5 4 3 Day 6 e 8 6 4 8 6 4 Ad Cre Day Day 3 f 4 35 3 5 5 5 Ad Cre 5 3 6 Time after glucose injection (min Supplementary Figure 6. Over-expression or deletion of XBPs in the liver of normal diet-fed lean mice shows little effects on glucose homeostasis. (a d Normal diet-fed, seven-week-old, 7 male, WT mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (4 PFU g through tail vein. (a Fed blood glucose levels on day 3 post-infection. (b Glucose tolerance test on day 5 after infection. (c Insulin tolerance test on day 7 post-infection. (d Blood glucose levels in 48-hr Flox/Flox fasted mice on day 6 after infection. (e, f Normal diet-fed, six week-old, male Xbp mice 8 were injected with either Ad-Cre or Ad-LacZ ( x PFU per mouse. (e Blood glucose levels on and 3 days after injection. (f Glucose tolerance test on day 35 post-infection.error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5. Zhou, et al. Supplementary Figure 6 Nature Medicine doi:.38/nm.93

a Ad Cre Tun + + + + d e Blood glucose (%Basal h Relative mrna level 5 4 3 XBPs Lamin A/C Ad-LacZ Ad-Cre 5 3 6 9 Time after glucose injection (min 8 6 4 Ad-LacZ Ad-Cre 5 3 6 9 Time after insulin injection (min.5.5 G6pc Pck Ppargca b f Ins IP: IR IP: IRS g Lysate Nuclear 8 6 4 Ad Cre c.6..8.4 Ad Cre Day 4 Day 7 Day 4 Ad Cre + + + + + + Ad Cre PY IR FoxO Tubulin FoxO PY IRS pakt Akt S473 Lamin A/C.4.8..5.5.5.5 3 3 4 5 Supplementary Figure 7. XBPs deficiency in the liver leads to accumulation of FoxO and creates glucose intolerance. Xbp flox/flox mice fed on HFD for 4 weeks were injected with Ad-Cre (n = 9 or Ad-LacZ (n = 9. (a Mice were injected with tunicamycin intraperitoneally on postinjection day 5 and XBPs levels were analyzed in the liver samples. (b Blood glucose levels were measured on post-injection day 4 and (c plasma insulin levels were determined on postinjection day 7 and 4. (d GTT on day 7 and (e ITT on day 4 after injection. (f In vivo insulin receptor signaling in the liver of adenovirus-injected mice. (g Total and nuclear FoxO levels in the liver. (h mrna levels of G6pc, Pck and Ppargca mrna levels in the liver. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <., P <.. Plasma insulin (ng ml Ad Cre Zhou, et al. Suplementary Figure 7 Nature Medicine doi:.38/nm.93

Supplementary Methods Reagents. XBP, phosphotyrosine, HA, IR β, and actin specific antibodies, HRP conjugated goat anti mouse and goat anti rabbit antibodies were from Santa Cruz Biotechnology. FoxO, FoxO3a, phospho-akt Thr38, phospho-akt Ser473, Akt, ubiquitin, α-tubulin, and lamin A/C specific antibodies were from Cell Signaling Technology. IRS specific antibody was from Millipore. Flag specific antibody, streptozotocin (STZ, and sodium pyruvate were from Sigma Aldrich. MG3 and Akti- VIII were from EMD Biosciences. BEZ35 was from Chemie Tek. Dulbecco s Modified Eagle Medium (DMEM, Opti MEM, F Nutrient Mixture, fetal bovine serum (FBS, Lipofectamine, LR Clonase II Enzyme Mix, TOP chemically competent cells, and Trizol were from Invitrogen. Nuclear Extraction Kit and Dithiobis (succinimidyl propionate were from Thermo Scientific. Detergent compatible protein assay kit, SYBR Green Supermix, and cdna Synthesis Kit were from Bio RAD. Fast Start Taq DNA polymerase and BM Chemiluminescence Blotting Substrate were from Roche. Dual luciferase reporter assay system was from Promega. Restriction enzymes, T4 Polynucleotide Kinase, and T4 DNA Ligase were from New England Biolabs. EasyTag EXPRESS 35 S Protein Labeling Mix and D [3 3 H] Glucose were from PerkinElmer. Cell culture. We cultured Mouse Embryonic Fibroblasts (MEFs and 93A cells in DMEM supplemented with % FBS, U ml penicillin and mg ml streptomycin. We cultured Chinese Hamster Ovary (CHO cells in F Nutrient Mixture supplemented with % FBS, U ml penicillin and mg ml streptomycin. We maintained cells at 37 o C in a 5% CO humidified atmosphere. Adenovirus production. We generated adenovirus with ViraPower Adenoviral Expression System (Invitrogen. We digested 5 μg of adenoviral constructs with Pac I and transfected the linearized DNA into 93A cells. We cultured the transfected cells until visible regions of cytopathic effect formed and expanded. We collected adenovirus Nature Medicine doi:.38/nm.93

producing cells and subjected cells to 3 cycles of freezing and thawing to release adenovirus. We stored adenovirus at 8 o C for later use. Adenovirus for animal experiments were amplified in 93A cells, purified with CsCl gradient ultracentrifugation, confirmed to be replication incompetent, and titrated. FoxO knockdown adenovirus generation. We generated FoxO knockdown adenovirus (Ad shfoxo with a targeting sequence as 5 -GAGCGTGCCCTACTT CAAG-3, which targets to a coding region of mouse Foxo gene. Nuclear protein extraction. We washed cells with ice cold PBS once and lysed cells with hypotonic lysis buffer ( mm HEPES, ph7.5; mm KCl; mm NaF; mm MgCl ; mm EDTA; mm EGTA; mm DTT;. mm Na 3VO 4; μg ml Leupeptin; μg ml Aproptonin; mm PMSF and nm Okadaic acid. We incubated cell lysates on ice for min and then mixed them with /6 volume of % NP 4 thoroughly. We vortexed samples and centrifuged them at 6,g, 4 o C for min. We saved supernatants as cytoplasmic fractions and pellets as nuclei. We extracted nuclear proteins from nuclei with nuclear lysis buffer (5 mm HEPES, ph 7.5; 5 mm NaCl; mm NaF; 5 mm MgCl; mm DTT; % Glycerol;.% NP 4; containing mm DTT;. mm Na 3VO 4; μg ml Leupeptin; μg ml Aproptonin; mm PMSF and nm Okadaic acid by repeated vortexing. We centrifuged samples at 6,g, 4 o C for min and saved supernatants as nuclear fractions. We extracted nuclear proteins from tissues using NE PER Nuclear and Cytoplasmic Extraction Reagents (Thermo per the manufacturer s instructions. We cut mg of liver tissues into small pieces and homogenized them with a tissue grinder in the hypotonic cytoplasmic buffer. We centrifuged tissue lysates at 6,g, 4 o C for 5 min to separate cytoplasmic proteins in the supernatants and nuclei in the pellets. We extracted nuclear proteins from nuclei with Nuclear Extraction Buffer by vortexing and centrifugation. Nature Medicine doi:.38/nm.93

Western blotting. We lysed cells with pre chilled lysis buffer (5 mm Tris HCl, ph 7.4; mm NaF; mm Na 4P O 7; mm Na 3VO 4; mm EGTA; mm EDTA; % NP 4; mg ml Leupeptin; mg ml Aproptonin; mm PMSF and nm Okadaic acid and incubated lysates on ice for min. We centrifuged cell lysates at 6,g, 4 o C for min and collected supernatants for protein concentration determination. We boiled protein samples in Laemmli buffer at o C for 5 min. We resolved proteins by SDS PAGE and electrotransferred proteins onto polyvinylidene fluoride membranes. We blocked membranes in % blocking reagent (Roche at room temperature for h. We incubated blots with primary antibody at 4 o C overnight and with secondary antibody at room temperature for h. After extensive washing, we developed blots using a chemiluminescence assay system (Roche and exposed blots to films for appropriate time period. We performed densitometry with Image J (NIH for signal quantification on immunoblots. For reprobing, we incubated blots in a stripping buffer (6.5 mm Tris HCl, ph 6.7; % SDS; mm mercaptoethanol at 5 o C for min with vigorous shaking. We washed blots with Tris Buffered Saline containing.% Tween and incubated blots with blocking buffer, primary and secondary antibodies in sequence. FoxO ubiquitination. We cultured MEFs in cm cell culture dishes. We transfected cells with 5 μg of ubiquitin expressing plasmids and then infected cells with or 6 h after transfection. After 6 h incubation with adenovirus, we treated cells with μm MG3 or DMSO for h. We lysed cells with lysis buffer and cleared cell lysates by centrifugation at 6,g, 4 o C for min. We incubated cell lysates with FoxO specific antibody overnight and with Protein A sepharose beads for additional h at 4 o C. After extensively washing, we boiled immunoprecipitates in Laemmli buffer and subjects protein samples to Western blotting with ubiquitin specific antibody. Reverse transcription and quantitative real time PCR. We extracted total RNA from cells or animal tissues using Trizol reagent (Invitrogen according to the manufacturer s Nature Medicine doi:.38/nm.93

instructions. We conducted reverse transcription with μg of total RNA using a cdna synthesis kit (Bio Rad under the following conditions: 5 C for 5 min, 4 C for 3 min, and 85 C for 5 min. We analyzed the abundance of gene expression with SYBR Green Supermix on iq5 Multicolor Real Time PCR Detection System (Bio Rad. We normalized gene expression levels with 8S ribosome RNA (Rn8s level. The primer sequences were as follows. Rn8s forward: Rn8s reverse: Dnajb9 forward: Dnajb9 reverse: Pdia3 forward: Pdia3 reverse: Hspa5 forward: Hspa5 reverse: G6pc forward: G6pc reverse: Pck forward: Pck reverse: Ppargca forward: Ppargca reverse: Igfbp forward: Igfbp reverse: Foxo forward: Foxo reverse: Insr forward: Insr reverse: 5 -AGT CCC TGC CCT TTG TAC ACA-3 ; 5 -CGA TCC GAG GGC CTC ACT A-3 ; 5 -CCC CAG TGT CAA ACT GTA CCA G-3 ; 5 -AGC GTT TCC AAT TTT CCA TAA ATT-3 ; 5 -GAG GCT TGC CCC TGA GTA TG-3 : 5 -GTT GGC AGT GCA ATC CAC C-3 ; 5 -TCA TCG GAC GCA CTT GGA A-3 ; 5 -CAA CCA CCT TGA ATG GCA AGA-3 ; 5 -CCG GTG TTT GAA CGT CAT CT-3 ; 5 -CAA TGC CTG ACA AGA CTC CA-3 ; 5 -ATC ATC TTT GGT GGC CGT AG-3 ; 5 -ATC TTG CCC TTG TGT TCT GC-3 ; 5 -TGA TGT GAA TGA CTT GGA TAC AGA CA-3 ; 5 -CAA TGC CTG ACA AGA CTC CA-3 ; 5 -GAGAGCCCAGAGATGACAGA-3 ; 5 -TCCATCCAGGGATGTCTCAC-3 ; 5 -GTG AAC ACC ATG CCT CAC AC-3 ; 5 -CAC AGT CCA AGC GCT CAA TA-3. 5 -AATGGCAACATCACACACTACC-3 ; 5 -CAGCCCTTTGAGACAATAATCC-3 ; Animal. We purchased leptin deficient (ob/ob and WT mice from the Jackson Laboratory and housed mice in a temperature controlled, air conditioned and specific Nature Medicine doi:.38/nm.93

pathogen free animal facility at Children s Hospital Boston on h light and h dark cycle. Mice were fed with normal chow or a high fat diet (45% calorie from fat, Research Diets Inc., and had a free access to water. We performed all animal experiments in accordance with the protocols approved by Animal Care and Use Committee at Children s Hospital Boston. STZ induced type diabetes mouse model. We dissolved STZ powder in ice cold. M sodium citrate solution (ph 4.5 immediately before use. We injected 8 week old, male C57BL6/J mice with STZ solution ( mg kg intraperitoneally. We measured blood glucose levels in STZ injected mice 5 d after injection. We used mice with blood glucose level around 5 mg dl for experiments. Adenovirus injection through tail vein. We thawed adenovirus at room temperature right before injection and diluted virus with saline to a final volume of μl per mouse. We put mice in a restrainer and heated the tail with a heating lamp to achieve vasodilatation. We injected adenovirus to mice through tail vein with a 8 gauge needle. After injection, we applied mild pressure at the injection spot until no bleeding. Blood glucose and plasma insulin measurements. We measured mouse blood glucose levels with whole blood from tail vein using a glucose meter (Bayer. For plasma insulin measurement, we collected mouse blood from tail vein with heparin treated capillary tubes and incubated blood on ice until centrifugation. We harvested plasma by centrifugation at 8,g, 4 o C for min and measured plasma insulin concentration with an Ultra Sensitive Mouse Insulin ELISA kit from Crystal Chem. Glucose Tolerance Test (GTT, Insulin Tolerance Test (ITT and Pyruvate Tolerance Test (PTT. For GTT, we fasted mice overnight (7 pm 9 am and injected mice with D glucose intraperitoneally. We measured blood glucose levels, 5, 3, 6, 9 and min after injection. The dose of glucose injection was.5g kg for ob/ob mice; Nature Medicine doi:.38/nm.93

g kg for LIRKO mice and IRS/IRS DKO mice; g kg for Xbp Flox/Flox mice. For ITT, we fasted mice for 6 hours (8 am pm and injected mice intraperitoneally with recombinant human insulin from Eli Lilly. We measured blood glucose levels, 5, 3, 6, 9 and min after insulin injection. The dose of insulin injection was IU kg for ob/ob mice; IU kg for LIRKO, IRS/IRS DKO and Xbp Flox/Flox mice. For PTT, we fasted mice overnight (7 pm 9 am and injected mice intraperitoneally with sodium pyruvate solution ( g kg. We measured blood glucose levels, 5, 3, 6, 9 and min after pyruvate injection.. Dong, X.C., et al. Inactivation of hepatic Foxo by insulin signaling is required for adaptive nutrient homeostasis and endocrine growth regulation. Cell Metab 8, 65-76 (8. Nature Medicine doi:.38/nm.93