a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas Supplementary Figure 1: Tissue-specific inflamamtion caused by T cells isolated from Ctla4 / mice. CD4 + T cells (1 1 5 cells) purified from spleen of Ctla4 +/+ mice,or spleen, lung, or pancreas of Ctla4 / mice were transferred into Rag2 / mice. Pancreas, lung, and heart from individual recipients were removed 3 weeks after transfer. (a) The numbers of CD4 + T cells recovered from pancreas, lung, and heart of each Rag2 / recipient mice is shown. Each bar shows the mean + s.d. from three individual mice. (b) H&E-stained sections of the pancreas, lung and heart from Rag2 / recipients of CD4 + T cells isolated from the spleen of Ctla4 +/+ mice, or from spleen, lung, or pancreas of Ctla4 / mice. The results shown are representative of two independent adoptive transfer experiments.
DO11.1 (Rag2 / ) Ctla4 +/+ or Ctla4 / T cells T cells from pancreas RNA DOβ TCRα cdna library DOα Thy1.1 DOβ DOα TCRα DOβ Rag2 / mice Supplementary Figure 2: Scheme of generation of DO11.1 T cells expressing TCRα cdna RV library.
Uninfected Empty TCRα library DO11.1 Rag2 / Ctla4 +/+.8 45 49 DO11.1 Rag2 / Ctla4 /.8 34 43 Thy1.1 Supplementary FIgure 3: Thy1.1 expression on T cells after retroviral infection. CD4 + T cells from DO11.1 Rag2 / Ctla4 +/+ or DO11.1 Rag2 / Ctla-4 / mice were infected with empty- or TCRα-library. Thy1.1 expression was determined by flow cytometry 5 days after infection. The numbers in each histogram represent the percentage of Thy1.1 + cells. The dotted histogram shows staining by isotype-control antibody.
a Thy1.1 CD4 Lung Pancreas 4.4 16.7 b CD4 + Thy1.1 + cells (%) 2 15 1 5 P<.5 P<.5 NS 4 7 14 21 Time after transfer (d) Lung Pancreas 3.2 75.2 c Ki-67 + cells (%) 1 75 5 25 P<.5 P<.5 P<.5 Lung Pancreas d Ki-67 Ctla4 +/+ 4 7 14 21 Time after transfer (d) 38 isotype 1 Ki-67 62 CD4 CD4 e Ctla4 / Lung Pancreas 79 84 89 isotype 1 Ki-67 21 16 11 CD4 CD4 Supplementary Figure 4:Tissue-specific proliferation of Ctla4 -/- T cells that express the TCRα library derived from pancreas-infiltrating T cells. (a-c) CD4 + T cells from DO11.1 Ctla4 -/- were infected with TCRα library and transferred to Rag2 -/- mice. (a) Lung and pancreas were removed 14 days after transfer and cells were stained for CD45.2, CD4, Thy1.1 and intracellular Ki-67. CD4 and Thy1.1 expression on CD45.2 + cells (top) and Ki-67 expression in CD45.2 + CD4 + Thy1.1 + cells (bottom) are shown. The data are representative of three individual mice. Shaded histogram shows staining by isotype-control antibody. The percentage of CD4 + Thy1.1 + cells (b) and Ki-67 + cells among CD4 + Thy1.1 + cells (c) at the indicated time points are also shown. Each bar shows mean+ s.d. from three individual mice. (d, e) CD4 + T cells were purified from spleen, lung, or pancreas of Ctla4 +/+ or Ctla4 -/- mice. Cells were stained for CD45.2, CD4 and intracellular Ki-67. Plots are gated on CD45.2 + CD4 + cells.
a Blood glucose (mg/dl) 2 15 1 5 P<.5 DOβCtla4 +/ DOβCtla4 / b Blood glucose (mg/dl) 15 125 1 75 P<.5 5 7 14 21 Time after transfer (d) Supplementary Figure 5: DOβCtla4 -/- mice do not develop diabetes. (a) Blood glucose concentrations in 7-wk-old DOβCtla-4 +/- ( ) or DOβCtla4 -/- ( ) mice. (b) Blood glucose concentrations in Rag2 -/- recipients of CD4 + T cells (1 1 5 cells) from the spleen of DOβCtla4 +/- mice (n=4; ) or from the pancreas of DOβCtla4 -/- mice (n=4; ). The results shown are representative of two independent adoptive transfer experiments.
a 8 6 IL-2 (pg/ml) 4 6 4 2 <6.3 <6.3 <6.3 <6.3 <6.3 (-) Pdia2 Carbonic anhydrase II α-amylase Lactoferrin Carboxypeptidase B α-cd3 b Medium Pdia2 Carbonic anhydrase II.76 1.64.81 α-amylase Lactoferrin Carboxy- -peptidaseb.95.94.61 GFP Supplementary Figure 6: T cell responses against exocrine pancreas antigens. (a) CD4 + T cells (1 1 5 cells) purified from pancreatic lymph nodes of 2-day-old Ctla4 -/- mice were cultured with 1 μm of the indicated proteins in the presence of irradiated splenocytes (5 1 5 cells) or with anti-cd3 (positive control). The supernatants were harvested 24 h later and IL-2 concentrations were determined by ELISA. (b) T cell hybridomas (2.5 1 4 cells) expressing DOβ and the TCRα library together with the NFAT-GFP reporter were cultured with 1 μm of the indicated proteins in the presence of irradiated splenocytes (5 1 5 cells). GFP expression was examined after 2 h.
T cells from pancreas 58α - β - RNA TCRα cdna RV library +hcd4-gfp-nfat-rv +DOβ-mCD4-RV NFAT -GFP DOβ TCRα Supplementary Figure 7: Scheme of generation of T cell hybridomas expressing TCRα library. TCRα cdna generated from pancreas-infiltrating CD4 + T cells as in Figure 3 was ligated with retrovirus vector lacking IRES-Thy1.1 to generate the TCRα cdna RV library. 58α - β - hybridomas were infected with NFAT-GFP-hCD4 RV reporter and DOβ-mCD4 RV. Sorted hcd4 + mcd4 + cells were infected with TCRα cdna library RV. CD3 + cells were sorted to obtain TCRαβ + cells.
Leader TRAV9D-1*1 TRAJ44*1 TRAC agaaagttcccagggccaggaccacttctgcagggtttttttttttctttagaatttta cgtacaacaggaaggtgtctagtaaaccttatgccaactgtctccaagaactgggaaca gcctctttcctgcacgagccaggtttttccagaaaggcaccagagctgtttccagtgtg cagccatgctcctggttctcatctcgttcctcgggatacatttcttcctggatgtccaa acacagacagtttcccagtctgatgcccatgtcactgtcttcgaaggagactcggtgga gctgagatgcaactattcctatggtggatccatttacctctcctggtacatccagcacc atggccgtggcctccagtttctcctcaagtactattcgggaaacccagtggttcaagga gtgaacggcttcgaggctgagttcagcaagagcgactcttccttccaccttcggaaagc ctccgtgcactggagcgactcggctgtgtacttctgtgctgcgagcagaggtggcagtg gtggaaaactcactttggggactggaacaagacttcaggtcaaccttgacatccagaac ccagaacctgctgtgtaccagttaaaagatcctcggtctcaggacagcaccctctgcct gttcaccgactttgactcccaaatcaatgtgccgaaaaccatggaatctggaacgttca tcactgacaaaactgtgctggacatgaaagctatggattccaagagcaatggggccatt gcctggagcaaccagacaagcttcacctgccaagatatcttcaaagagaccaacgccac ctaccccagttcagacgttccctgtgatgccacgttgaccgagaaaagctttgaaacag atatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaa gtagcgggatttaacctgctcatgacgctgaggctgtggtccagttga Supplementary Figure 8: cdna sequence of 29TCRα The sequence of TCRα cdna recovered from Pdia2-specific T cell clone #29. The sequences of leader, variable (TRAV9D-1*1), joint (TRAJ44*1), or constant region are shown in blue, red, green, or violet, respectively.
Medium alone OVA323-339 Pdia2 3 64 73 2 3 55 Empty DO11.1 Ctla4 +/+ 6 27 3 66 25 75.3 3 1 32 45 3 29TCRα 1 21 21.3 7 18 5 7 81 3 2 68 Empty DO11.1 Ctla4 / 7 5 18 66 16 81.1 5 9 48 21 29 29TCRα Thy1.1 4 CFSE 24 13 1 6 16 Supplementary Figure 9: Antigen-specific proliferative response of T cells infected with Pdia2-specific TCRα. CD4 + T cells from DO11.1 Ctla4 +/+ or DO11.1 Ctla4 -/- mice were infected with empty or 29TCRα. T cells were recovered 5 days after infection, labeled with CFSE, and cultured with or without OVA323-339 (.3 μm) or Pdia2 (1 μm) in the presence of irradiated splenocytes. 3 days later, CFSE dilution was examined by flow cytometry.
a CD4 + gate with BALB/c BM 1.2.5 6 DO11.1 Ctla4 +/+ BM infected with 29TCRα RV-GFP 54.8 43.5 87 7. 2.6.6 8 DO11.1 Ctla4 / BM infected with 29TCRα RV-GFP CD25 45.7 51.1 GFP 88.8 3.2 b with BALB/c BM DO11.1 Ctla4 +/+ BM infected with 29TCRα RV-GFP DO11.1 Ctla4 / BM infected with 29TCRα RV-GFP Supplementary Figure 1: CTLA-4 controls the pathogenicity of Pdia2-specific T cells in cell-intrinsic and cell-extrinsic manners. BM from DO11.1 Ctla4 +/+ or DO11.1 Ctla4 -/- mice was infected with 29TCRα GFP RV and adoptively transferred into lethally irradiated Rag2 -/- mice with or without BM from BALB/c mice. CD25 and GFP expression in splenic CD4 + T cells (a) and H&E stained sections of pancreas (b) 6 weeks after BM transfer are shown.