Supplemental Figure 1

Similar documents
Supplementary Figure 1 IL-27 IL

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Tbk1-TKO! DN cells (%)! 15! 10!

Nature Medicine: doi: /nm.3922

SUPPLEMENTARY INFORMATION

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

D CD8 T cell number (x10 6 )

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

SUPPLEMENTARY INFORMATION

Supplemental Materials

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

SUPPLEMENTARY INFORMATION

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Transduction of lentivirus to human primary CD4+ T cells

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Supplementary Figures

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Dual Targeting Nanoparticle Stimulates the Immune

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Nature Medicine doi: /nm.3957

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

Supplementary Figures

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Supplemental Figure Legends

SUPPLEMENT Supplementary Figure 1: (A) (B)

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figures

Supplementary. presence of the. (c) mrna expression. Error. in naive or

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Relevant Disclosures

SUPPLEMENTARY INFORMATION

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplementary Figure 1.

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,

Transcription factor Foxp3 and its protein partners form a complex regulatory network

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

USP15 stabilizes MDM2 to mediate cancer cell survival and inhibit antitumor T cell responses

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Supplementary Data Table of Contents:

Supplemental Table I.

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate

Supporting Information Table of Contents

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

NK cell flow cytometric assay In vivo DC viability and migration assay

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

SUPPLEMENTARY INFORMATION

Supplementary Information:

Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells

SUPPLEMENTARY FIGURES

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figures

Appendix Figure S1 A B C D E F G H

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

SUPPLEMENTARY INFORMATION

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Supplementary Figures

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Transcription:

Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb IFN-γ TNF-α TGF-β1 NFATc1 -TTTTTCC-3 -TTTTTGG-3 +1 Gated on CD4+ T cells Gated on CD8+ T cells pdcd1 1d 1b PD1 MFI (x1 4 ) Relative Luciferase Unit 4 3 2 1 15 12 9 6 3 DMSO.1.1 1 1 CsA Concentrations (µg/ml) * NFATc1 Mut Medium + TGF-β1 Medium 1e Relative Luciferase Unit 3 2 1 EV 4 8 Medium +TGF-β1 * * TGF-βRI/RII (µg) 1f SSC Isotype Empty Vector TGF-βRI/RII (4µg) 1 8 6 4 2 1 8 6 4 2 1.27% 1 8 6 4 2 7.25% 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 TGF-βRII 1g Gapdh Pdcd-1 Fold Enrichment Relative to IgG 15 1 5 Fold Enrichment Relative to IgG 15 1 5 Medium +TGF-β1 +TGF-β1+SB431542 IgG αnfatc1 IgG αnfatc1

Supplemental Figure 2 2a mrna expression relative to mock 1.4 1.2 1..8.6.4.2. Scramble mrna expression relative to mock 1.6 1.4 1.2 1..8.6.4.2. Scramble 2b IB: IB: β-actin IB: IB: β-actin Mock Mock 2c 2d Isotype Ova Ova+TGF-β1 IB: IB: β-actin IB: IB: β-actin #1 #2 #1 #2 #1 #2 OT-I OT-II 1 8 6 4 2 1 1 1 1 2 1 3 1 4 1 8 6 4 2 MFI 67.2 MFI 112 MFI 21.1 MFI 76.4 1 8 6 4 2 1 1 1 1 2 1 3 1 4 1 8 6 4 2 MFI 826 MFI 485 MFI 15 MFI 94.3 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 PD-1 LAG3 2e 2f CD8+ TILs CD4+ TILs LAG3+[%] normalized to 3. 2.5 2. 1.5 1..5 * PD1+[%] normalized to 2.5 2. 1.5 1..5

Supplemental Figure 3 3a PD-1 1 5 1 4 1 3-1 3-1 3 1 3 1 4 1 5-1 3 1 3 1 4 1 5 CD4 1 8 6 4 2 Foxp3 1 CD4+ Foxp3+ [%] 9 8 7 6 Plot CD4+ 1 PD1+ 5 3b +TGF-β1 Count 1 8 6 4 2 Foxp3- Foxp3+ 1 1 1 1 2 1 3 1 4 Foxp3-GFP Count 8 6 4 2 Gated on Foxp3+ or Foxp3- Foxp3- Foxp3+ 1 1 1 1 2 1 3 1 4 1 8 6 4 2 1 1 1 1 2 1 3 1 4 PD-1 Isotype +TGF-β1 : Gated on Foxp3+ subset +TGF-β1 : Gated on Foxp3- subset 3c

Supplemental Figure 4 4a 1 8 6 4 2 Isotype 1 8 6 4 2 Representative Plots 1 8 6 4 2 4b Proliferation [%] 8 6 4 2 8 N N 1 8 6 4 2-1 3 1 3 1 4 1 5-1 3 1 3 1 4 1 5-1 3 1 3 1 4 1 5 1 8 6 4 2-1 3 1 3 1 4 1 5-1 3 1 3 1 4 1 5-1 3 1 3 1 4 1 5 CFSE PD-1 LAG3 1 8 6 4 2 LAG3 MFI PD-1 MFI 6 4 2 3 25 2 15 1 5 4c N 1 8 6 4 2-1 3 1 8 6 4 2-1 3 Isotype 1 3 1 4 1 5 1 3 1 4 1 5 1 8 6 4 2 1 8 6 4 2 Representative Plots 1 4 1 5 1 4 1 5 1 8 6 4 2 1 8 6 4 2-1 3-1 3 1 3 1 4 1 5 1 3 1 4 1 5 CFSE PD-1 LAG3 4d Proliferation [%] PD-1 MFI LAG3 MFI 8 6 4 2 2 1-1 25 2 15 1 5 N

Supplemental Figure 5 5a 5b TIL Tumor Volume (mm3) 8 6 4 2 5 1 15 2 25 Days * PD-1 MFI (Gated on PD-1+) 1 5 1 4 * 1 5 PD-1 MFI (Gated on PD-1+) 1 4 1 3 5c 25 TIL 2 LAG3+ [%] 2 15 1 5 LAG3+ [%] 15 1 5 5d 1 1 +TGF-β1 8 6 4 2 8.45% 8 6 4 2 2.81% 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 1 1 8 6 9.41% 8 6 7.89% SSC 4 2 4 2 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 IL-2

1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 Supplementary Information Supplemental Figure 1. (a) The effect of various cytokines on PD-1 expression is shown as fold changes in MFI relative to the CD3/ CD28 condition with no cytokines in both CD4+ (black bars) and CD8+ (white bars) T cells. CD3+ T cells were enriched using magnetic isolation kits from the peripheral blood of healthy donors. The cells were activated with CD3/ CD28-conjugated beads in the presence of an individual cytokine (data from 5ng/ml is shown) with a cell to bead ratio of 1:1. In some experiments, a 1:3 cell to bead ratio was used with no changes in the relative effect of cytokines observed. After 72 hr, the cells were harvested and CD3+ CD4+ or CD3+ CD8+ were gated in order to assess respective PD-1 surface expression via flow-cytometry. (b) TGF-β induced proportionate increases in intracellular and surface PD-1 in the presence of CD3/ CD28 stimulation as described in (a). (c) Human peripheral CD3+ T cells were isolated and activated with CD3/ CD28-conjugated beads in the absence or presence of TGF- 1 for 72 hr. Cyclosporine A (CsA) was added after 24 hr of activation at varying concentrations and PD-1 expression was assessed by flow-cytometry: medium alone (filled circles); CD3/ CD28 (open circles); CD3/ CD28+TGF- 1 (filled triangles). The result is representative of two independent trials. (d) A putative NFATc1 binding site relative to Smad-binding elements (SBE) on a human Pdcd-1 promoter region. (e) Jurkat T cells were transfected with a luciferase vector containing wild-type () or mutant (Mut) NFATc1 site of the human Pdcd-1 promoter as described in the Method section, and luciferase activity was measured after activation with CD3/ CD28. The result is shown as the mean +/- SEM of technical replicates and is representative of at least two independent trials. (f) Jurkat T cells were transfected with a 1.9 kb long human Pdcd-1 promoter-driven luciferase vector together with different amounts of TGF- RI and RII expression plasmids. Subsequently, the cells were activated with CD3/ CD28 with (white bars) or without TGF- 1 (grey bars) and luciferase activity was measured. The result is shown as mean +/- SEM of technical replicates and representative of at least two independent trials. (g) Transfection efficiency of TGF- RI and RII expression plasmids on Jurkat T 1

26 27 28 29 3 31 32 33 cells by flow-cytometry, as shown in SSC (Y-axis) and TGF- RII (X-axis) (right). EV: empty vector. The result is representative of two independent trials. (g) Chromatin immunoprecipitation analysis of NFATc1 on the human Pdcd-1 promoter. Human peripheral CD3+ T cells were isolated and activated with CD3/ CD28-conjugated beads in the absence (black bars) or presence (hatched bars) of TGF- 1 for 24 hr and the ChIP assay was performed as described in the Method section. The degree of enrichment is shown as fold-change (Y-axis) relative to non-specific binding by an isotype control in a human Gapdh or Pdcd-1 promoter region. The result is shown as the mean +/- SEM of technical replicates and representative of at least two independent trials. 34 35 36 37 38 39 4 41 42 43 44 45 46 47 48 49 5 Supplemental Figure 2. (a) qpcr analysis of and mrna levels in Jurkat T cells. Jurkat T cells were transfected with scramble, and as described in the Method section. After resting overnight, the cells were harvested and cellular RNA was isolated in order to assess and transcript levels. The result is shown as mean +/- SEM of technical replicates and representative of at least two independent trials. (b) transfected Jurkat T cells were harvested and lysed for western blot analysis of and. (c) Western blot analysis of Cre-mediated gene knock-out in and CD4+ T cells. Naïve CD4+ T cells (CD4+ CD25- CD62L+) were flow-sorted from, and mice and were activated with CD3/ CD28 for 72 hr. The cells were harvested and lysed for western blot analysis of and expression as described in the method section. Numbers represent biological replicates of each group. (d) Ovalbumin-specific CD8+ (OT-I) (top) and CD4+ (OT-II) (bottom) T cells were enriched by magnetic isolation from the spleen and activated for 72 hr with Type1 Ovalbumin (Ova) and Type II Ova (1 µg/ml) in the presence of irradiated splenocytes under different conditions. PD-1 (left) and LAG3 (right) expressions are shown in representative histograms: isotype (shaded histogram), peptide alone (thin histogram), peptide with TGF- 1 (5 ng/ml) (bold histogram). (e) Average CD8+ LAG3 + percentages in and TIL are shown as normalized 2

51 52 53 values to CD8+ LAG3+ percentages. (f) Average CD4+ PD-1+ percentages in and TIL are shown as normalized values to CD4+ PD-1+ percentages. The data were analyzed using Student s t-test and considered significant if *p<.5, **p<.1, ***p<.1. 54 55 56 57 58 59 6 61 62 63 Supplemental Figure 3. (a) Foxp3 expression in CD4+ PD-1+ T cells infiltrating the tumor microenvironment in, and mice. A representative Foxp3 expression histogram is shown (left) and percentage of Foxp3 among PD-1+ CD4+ T cells in each group is shown as mean +/- SEM. (b) CD4+ T cells were magnetically isolated from Foxp3-GFP transgenic mice, and were activated with CD3/ CD28 for 72 hr with or without TGF- 1. PD-1 expression was separately assessed on GFP+ and GFP- subsets as shown in representative histograms: isotype (light shade); CD3/ CD28 (dashed line); GFP+ subset from CD3/ CD28+TGF- 1 (dark shade); GFP- subset from CD3/ CD28+TGF- 1 (black line). (c) Average PD-1 MFI on CD4+ Foxp3+ (left) and CD4+ Foxp3- (right) are shown in, and TIL isolated from MC38. 64 65 66 67 68 69 7 71 Supplemental Figure 4. (a) Representative histograms of CFSE (left), PD-1(middle) and LAG3 (right) expression on (thin grey histogram) and (thin black histogram) OT-I cells originating from the draining lymph nodes () (top) and non-draining lymph nodes (N) (bottom). (b) CFSE-, PD-1+ and LAG3+ OT-I subsets in s were gated based on OT-I cells from Ns. The percentage of CFSE- (top) and MFI of PD-1 (middle) and LAG3 (bottom) of each subset are shown as mean +/- SEM, and the data represent two independent trials. (c,d) The same analysis was performed on and OT-I cells and the data represent two independent trials. 72 73 74 75 Supplemental Figure 5. (a) and DNTGF RII Tg+ mice were injected with 1 5 B16 melanoma cells in foot-pads, and tumor volume (mm 3 ) is shown as mean +/- SEM on different days. (b) PD-1 MFI of PD-1+ CD8+ subset originating from the tumor microenvironment (left) and (right) is 3

76 77 78 79 8 assessed from each mouse on Day 27. (c) The percentage of the LAG3+ CD8+ subset originating from the tumor microenvironment (left) and (right) is assessed from each mouse on Day 27. (d) Isolated CD4+ T cells from and mice were activated with CD3/ CD28 for 72 hr with or without TGF- 1 and representative plots of IL-2 expression are shown. The data were analyzed using Student s t-test and considered significant if *P<.5. 4

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback