Final Report Project #625. Antigenic Drift in Infectious Bursal Disease Viruses. Daral J. Jackwood, Ph.D. The Ohio State University

Final Report Project #625 Antigenic Drift in Infectious Bursal Disease Viruses Daral J. Jackwood, Ph.D. The Ohio State University Food Animal Health Research Program, The Ohio State University/OARDC, 1680 Madison Ave, Wooster, Ohio 44691 December 17, 2009 Funded by U. S. Poultry and Egg Association

INDUSTRY SUMMARY Infectious bursal disease virus (IBDV) causes an immunosuppressive disease in young chickens. The disease (IBD) has been recognized as a significant problem in chickens for over four decades. Despite the use of vaccines to control IBDV, it continues, directly and indirectly via immune suppression, to cause economic losses in the poultry industry. The magnitude of these economic losses is difficult for poultry health care workers to appreciate because the immune suppression caused by IBDV often goes unnoticed. Hypothesis: A relatively limited number of point mutations contribute to antigenic drift in IBDV. These point mutations allow the virus to circumvent passive and active immunity afforded by IBDV vaccines. Objectives: 1. To create specific substitution mutations in defined regions of the hypervariable VP2 sequence of IBDV infectious clones and rescue the resulting virus. 2. Identify and characterize any phenotypic changes caused by the substitution mutations in vivo. Results: Objective 1: Full-length clones of Del-E and AR266 viruses were created with specific amino acid mutations at positions 254 or 318 in the hypervariable region of VP2. Viruses from these full-length clones were then created by transfection into cell culture. The mutated Del-E and AR266 strains were rescued from transfected cells and propagated in specific-pathogen-free (SPF) chicks. Although the transfections were successful, some of the rescued viruses did not replicate in SPF chicks. The rescue of Del-E with a 254 mutation (Del-E-254) was successful but viruses from AR266 and Del- E clones with mutations at 318 could not be rescued. Fortuitously, a virus we obtained from a field case of IBD had an identical amino acid sequence to Del-E except for an Alanine at position 222. This virus (Del-E-222) was used in Objecive 2. After examining hundreds of viruses in our database, naturally occurring viruses with point mutations at 318 were not found. The data suggest the D N mutation at 318 may be fatal for IBDV unless it is accompanied by a second mutation at position 321 or 322. Objective 2: To determine if the 222 or 254 mutations altered antigenicity, tenday-old specific-pathogen-free chicks were vaccinated with 89/03 (Del-E) and then challenged two weeks later with Del-E, Del-E-222 or Del-E-254. The results indicated that immunity to Del-E did not fully protect the chicks from the Del-E-222 or Del-E-254 viruses but they were protected from the homologous Del-E virus. Impact: The results of this study demonstrate that specific point mutations in the VP2 protein of IBDV can result in a measurable antigenic drift and others may be fatal to these viruses. The short term implication this has for the poultry industry is that diagnostic assays designed to identify the 254 and 222 amino acids will discover viruses that have antigenically important mutations. Although other amino acid mutations may also contribute to antigenic drift, the amino acids studied in this project appear to contribute to vaccination failure. This information will improve our long range ability to select new vaccine candidates and implement alternate control strategies. 2

SCIENTIFIC REPORT Materials and Methods: Viruses. The variant Del-E and Lukert classic AR266 strains were used as starting points for the production of full-length clones and selection of the challenge viruses. For Objective 2, the Del-E vaccine strain designated 89/03 was used to vaccinate specific-pathogen-free (SPF) chicks. This vaccine has an identical amino acid sequence to the variant Del-E except for two mutations in the hypervariable region of VP2 that cause attenuation and allow it to replicate in cell culture. These mutations are Histidine at position 253 and Threonine at position 284. Reverse genetics using point mutations identified these two amino acids to be critical to replication of IBDV in cell culture (2, 12, 14). The Q254H and A284T mutations do not appear to affect antigenicity of the 89/03 variant vaccine as it is widely used to protect against Del-E strain viruses. The rescue of Lukert AR266 viruses with mutations at amino acid position 318 was unsuccessful (see Results Section), thus, a Lukert vaccine strain was not needed for Objective 2. Viruses containing point mutations. The mutant virus Del-E-254 has an identical sequence to Del-E except for the S N mutation at position 254 (Figure 1). The mutant virus Del-E-222 has an identical sequence to Del-E except for the T A mutation at position 222 (Figure 1). Since both these mutant viruses are Q254 and A284, they will not replicate in cell culture and should be virulent for SPF chicks. Propagation of viruses. The 89/03 vaccine strain was propagated in BGM-70 (Buffalo green monkey) cell cultures (3) and Dulbecco s Modified Eagle Medium (DMEM, Gibco, Invitrogen Corp. Grand Island, NY) using standard procedures (6). Virus titers were determined in 96-well flat-bottom cell culture plates. Serial 10-fold dilutions were prepared and a 50 µl volume of each dilution was used to inoculate multiple wells. The results were reported as the highest dilution that infected 50% of the wells inoculated (TCID 50 ). The Del-E variant strain, Del-E-254 and Del-E-222 viruses were propagated in 4- week-old SPF chickens using our standard procedures (17). The titers of SPF chick propagated viruses were determined in 9-day-old embryonated chicken eggs. Eggs were inoculated via the chorioallantoic membrane (CAM) with a 0.1 ml volume of bursa homogenate diluted 10 fold in DMEM containing 10 µg/ml gentamicin sulfate (Gibco, Invitrogen Corp.) and 2.5 µg/ml amphotericin B (Gibco, Invitrogen Corp.). Embryos that died within 24 hr of being inoculated were discarded and the results were reported as the highest dilution that infected 50% of the eggs (EID 50 ). Attempts to rescue viruses from full-length clones were conducted in BGM-70 or Myoblast Japanese Quail cells designated QM7 (American Type Culture Collection: ATCC, CRL-1962). Production of full-length IBDV clones. The full-length Del-E and AR266 clones were prepared using RT-PCR (9) and site directed mutagenesis (Gene Tailor Site Directed Mutagenesis System, Invitrogen Corp., Carlsbad, CA). The primers used in the 3

RT-PCR to generate full-length clones were previously described (15). They included primers used to generate full length segment A clones: A1: 5 -AGAGAATTCTAATACGACTCACTATAGGATACGATGGGTCTGAC -3 A2: 5 -AGGGGACCCGCGAACGGATCC-3 ; and primers used to generate full-length segment B clones: B1: 5 -AGAGAATTCTAATACGACTCACTATAGGATACGATGGGTCTGACC-3 B2: 5 -GGGGGCCCCCGCAGGCG-3. The IBDV specific sequences are underlined and the T7 promoter sequences are shown in italics. An EcoRI restriction site (GAATTC) preceded the T7 promoter sequences. A high fidelity SuperScript III One-Step RT-PCR System with Platinum Taq (Invitrogen, Corp.) was used to amplify the IBDV genome segments. Primers were used at a concentration of 10 µmol and the RT and PCR reaction conditions were as follows: 55 o C for 45 min, 94 o C for 2 min, then 40 cycles of 94 o C for 15 sec, 58 o C for 30 sec and 68 o C for 3.5 min. After the 40 cycles, an extension at 68 o C for 5 min was included. Following amplification, the products were viewed via agarose gel electrophoresis and the correct size fragments were excised and purified using a Wizard SV Gel and PCR Clean-up System (Promega Corp., Madison, WI). The excised full-length products were ligated into the plasmid pcr-xl-topo vector (Invitrogen, Corp.) and the resulting products were used to transform DH5α E. coli. The pcr-xl-topo vector contains a kanamycin resistance gene so the transformed cells were placed on LB agar containing 50 µg/ml kanamycin. Following an overnight incubation at 37 o C, approximately 10 colonies from each transformation were selected for analysis. Sequence analysis of full-length clones. Transformed DH5α cells were propagated in 5.0 ml LB broth containing kanamycin at 37 o C overnight. The E. coli containing plasmids were collected from the broth via centrifugation (800 x g for 30 min) and the plasmids were extracted from the pellet of bacteria using a Wizard Plus SV Minipreps DNA Purification System (Promega, Corp.). Plasmids were digested with the restriction enzyme EcoRI and visualized using gel-electrophoresis (Figure 2). Plasmids containing the correct length inserts were sent for sequencing. Purified plasmids containing full-length clones were sent to the University of Wisconsin, Biotechnology Center, DNA Sequence Laboratory (Madison, WI) for sequencing and the nucleotide sequences were downloaded using Chromas (Technelysium Pty Ltd., Queensland, Australia). Analysis of the sequences was conducted using Accelrys Gene v2.5 (Accelrys, San Diego, CA). Initially only the hypervariable region of VP2 was sequenced using our standard primers IBD-1-700 5 - GCCCAGAGTCTACACCAT-3 and IBD-2-700 5 -CCCGGATTATGTCTTTGA-3. For some samples, sequence analysis of the entire full-length segment A and B clones became necessary to insure their quality. To sequence the entire length of the clones, primers were used for each of the genome segments as described in our previous study (10). These primers are listed in Table 1 and their locations on the IBDV genome are shown in Figure 3. In vitro transcription to produce full-length viral RNA. Using the full-length segment A and B cdna clones, the viral gene inserts were excised from the plasmid using EcoRI. Following restriction enzyme digestion, the viral gene inserts were 4

separated from the plasmid on a 0.8% agarose gel using electrophoresis (Figure 2). The viral gene cdnas were excised from the gel and purified using the Wizard SV Gel and PCR Clean-up System (Promega Corp., Madison, WI). These inserts were then used in a transcription reaction to produce RNA from the full-length cdna clones. An in vitro RNA transcription kit (Promega, Corp.) was used according to the manufacturer s instructions to produce IBDV RNA off the T7 promoter that was engineered into the primers used to produce full-length cdna. Following transcription, the samples were treated with RQ1 DNase to remove the DNA templates. The resulting RNA was used in the transfection assays. Transfection and rescue of mutant viruses. Two cell types were used for the transfection procedures. The BGM-70 (Buffalo green monkey) and QM7 (Japanese quail myoblast) cells were propagated in 96-well flat-bottom plates until the monolayer was approximately 80% confluent. The DMEM medium was then removed and a 100 µl volume of warm OPTI-MEM-I (Gibco, Invitrogen Corp.) was used to gently rinse the cells. A 100 µl volume of OPTI-MEM-I was then added to each well and the cells were incubated at 37 o C for 1 hr. The segment A and B RNA transcripts were combined and prepared for transfection using the Lipofectamine 2000 reagent (Invitrogen, Corp.). A 10 µl volume of the RNA transcripts was added to 25 µl of OPTI-MEM-I medium. Different concentrations of the Lipofectamine 2000 were tested for their transfection efficiency. Lipofectamne 2000 was added at 0.5, 1.0 or 1.5 µl to a 25 µl volume of OPTI-MEM-I medium. The solutions were mixed gently and incubated at room temperature for 5 min. The different dilutions of Lipofectamine 2000 were then added to the diluted RNA transcripts and incubation continued at room temperature for 20 min. The solutions were then added to separate wells in the 96-well plate. The cells were incubated at 37 o C for 48 hrs. Control wells containing 50 µl of the diluted Lipofectamine 2000 reagent without RNA transcripts were included. After the 48 hr incubation, the cells and media were harvested using 3 freeze-thaw cycles and the solution was examined for viable IBDV in four-week-old SPF chickens (see Propagation of Viruses). Five days post-inoculation, bursa tissues were harvested, bursa and body weights were measured and the samples were examined using RT-PCR for the presence of the IBDV genome. In vivo vaccination/challenge experiments. These in vivo experiments were conducted to examine if a measurable antigenic drift (change) had occurred as a result of a single mutation in the hypervariable region of VP2. Reverse genetic experiments resulted in the virus Del-E-254 that had an identical amino acid sequence to Del-E except at the amino acid position 254. This was confirmed by sequencing the entire viral genome segment A. A second virus designated Del-E-222, was identified using molecular epidemiology and sequence analysis demonstrated it was identical to Del-E except for a single amino acid mutation at position 222. In these in vivo experiments, three pathogenic viruses (Del-E, Del-E-222 and Del-E-254) were used to challenge vaccinated or non-vaccinated chicks. The Del-E-254 and Del-E-222 viruses were propagated in four-week-old SPF chickens. Four days following inoculation, the bursa tissues from infected birds were harvested and RT-PCR demonstrated the presence of the IBDV genome. Sequence 5

analysis confirmed the identity of the two viruses and the presence of the point mutations at 254 and 222 (data not shown). These bursa tissues served as the challenge inoculates for the in vivo experiments. Our stock Del-E challenge virus was also used to challenge birds in this experiment. A 10 3.0 EID 50 dose was used to challenge each bird. Experimental Design. Eight groups of ten-day-old SPF chickens were used (Table 2). Five birds were placed into each group. The birds in group 1 were nonvaccinated and non-challenged controls. The birds in groups 3, 5 and 7 were not vaccinated but were challenged. Birds in groups 2, 4, 6 and 8 were vaccinated with a live-attenuated Del-E vaccine at 10 days of age and those birds in groups 4, 6 and 8 were then challenged at 21 days of age (11 days post-vaccination). At the beginning of the experiment, on day 21 (prior to being challenged) and at necropsy, blood samples were collected for serology. Serum samples were tested in an in vitro virus-neutralization assay using our standard procedures and Del-E as the antigen (11). The sera were also tested using the IBD-XR ELISA kit (IDEXX, Corp. Westbrook, ME). Vaccinations. A live-attenuated Del-E vaccine designated 89/03 (Intervet, USA) was propagated in BGM-70 cells then used to vaccinate the ten-day-old SPF chickens in groups 2, 4, 6 and 8. Each bird was given a 10 3.0 EID 50 dose in a 0.1 ml volume via oral gravage. Challenges. Birds in groups 3 and 4 were challenged with a virulent Del-E virus. Birds in groups 5 and 6 were challenged with the Del-E-222 virus and birds in groups 7 and 8 were challenged with the Del-E-254 virus. The challenge viruses were administered at a 10 3.0 EID 50 dose/bird in a 0.1 ml volume via oral gravage. At 7 days following challenge, all birds were euthanized and blood was collected for serology. Bursa tissues were observed for gross lesions and then collected for histopathology. Bursa tissues were fixed in 10% neutral buffered formalin. Fixed tissues were sectioned at 4 µm and stained using hematoxylin and eosin. The tissue sections were examined by light microscopy and the severity of the lesions were graded based on the extent of the lymphocyte necrosis, follicular depletion and atrophy. Scores of 0 to 4 were used to indicate relative degree of severity, a score of 0 indicated absence of lesions, and scores 1 to 4 were for < 25%, 25 to 50%, 50 to 75% and >75% of follicles affected, respectively. Statistical analysis. The bursa/body weight ratios were compared by ANOVA and Fisher s least squares test for differences among the groups. Results and Discussion: The goal of these experiments was to determine if point mutations in the hypervariable region of VP2 can measurably alter antigenicity of IBDV. To reach this goal we proposed to generate point mutations in full-length clones of the IBDV genome, rescue the resulting viruses using reverse genetics and examine their antigenicity in vivo. Full-length clones of the variant Del-E and classic AR266 IBDV strains were prepared and used in this study. Production of mutated full-length IBDV clones. Three constructs (DE clones 1 3) using site directed mutagenesis (Gene Tailor Site Directed Mutagenesis System, Invitrogen, CA) and our variant virus (Del-E) infectious clone were prepared. The origin 6

of our Del-E infectious clone was not a cell culture adapted virus as originally proposed. Thus, in the hypervariable region of VP2 it had the amino acids (253Q, 284A) and did not replicate in cell culture. The full-length segment A clones and the mutations we generated in VP2 are as follows: Peak A Minor Epitope Peak B Virus 222 251 252 253 254 255 256 284 317 318 321 322 323 Del E T S V H S L V T S D A G E DE clone 1 T S V H N L V T S D A G E DE clone 2 T S V H S L V T S N A G E DE clone 3 T S V H N L V T S N A G E The resulting full-length clones were amplified using our standard RT-PCR procedures (7) and then sequenced through the hypervariable region of VP2 to identify and confirm the mutations at 254 and 318. The sequence data confirmed the amino acid mutations shown above. Amino acid 222 in VP2 has been identified as important in antigenic diversity (16). This amino acid is Threonine in Del-E. The affect of this amino acid on antigenicity would not be identified in our DE clones. Thus we prepared full-length clones of the AR226 virus. The AR266 virus has been identified as a Lukert classic virus based on nucleotide sequencing and phylogenic analysis (9). Peak A Minor Epitope Peak B Virus 222 251 252 253 254 255 256 284 317 318 321 322 323 AR266 L S V Q G L A T N G A G D AR clone 1 L S V Q N L A T N G A G D AR clone 2 L S V Q G L A T N N A G D The AR266 full-length clones were amplified using our standard RT-PCR procedures (7) and then sequenced through the hypervariable region of VP2 to identify and confirm the L222 and mutations at 254 and 318. The sequence data confirmed the amino acid mutations shown above. Genome segment B of the IBDV genome encodes the RNA-directed RNApolymerase (VP1). This genome segment is needed in the transfection procedure to rescue IBDV. We generated a full-length clone of segment B from the Del-E variant strain and used it for both the Del-E and AR266 transfections. A full-length clone was selected and sequenced in its entirety. The sequence data identified the clone to be fulllength with an appropriately sized open-reading-frame for VP1. Initial Transfection and Propagation of viruses. The full-length Del-E and AR266 virus clones with point mutations were transfected into BGM-70 cells. The DE clone 1 was transfected into BGM-70 cells and following one round of replication, the resulting Del-E-254 virus was harvested and passed in 4-week-old chicks. 7

Our data indicate that one round of replication occurs following transfection in cell culture but the virus generated cannot re-infect these cells. The number of virus particles generated however, was sufficient for the subsequent infection of 4-week-old SPF chicks. Four days following inoculation of four SPF chicks, the bursa showed a marked reduction in size compared to controls and RT-PCR demonstrated the presence of the IBDV genome. Bursa/body weight ratios indicated the bursa from infected birds (B/BW = 1.54 ± 0.98) were significantly smaller than the controls (B/BW = 5.62 ± 0.58). The rescue and propagation of IBDV with single mutations at the amino acid position 318 were unsuccessful. Full-length clones of the Del-E and AR266 viruses were produced that had 318 point mutations but when these full-length clones were used to transfect BGM-70 cells, no infectious virus was produced. These clones were completely sequenced to insure their integrity. Sequence analysis of the mutated full-length clones. Because the transfections were unsuccessful using our full-length clones with 318 mutations, the entire segment A of these clones was sequenced to insure no additional mutations, stop codons or truncations were affecting the results. The DE clone 2 (D318N), DE clone 3 (D318N) and AR Clone 2 (G318N) sequences were generated and compared to full-length sequences of the original Del-E and AR266 viruses. The results demonstrated that the DE clone 2 and DE clone 3 were exactly like their parent virus, Del-E except for the mutation at amino acid position 318 in VP2. Likewise, the AR clone 2 sequence was identical to the parent virus, AR266 except for the mutation at position 318. Thus, the open-reading-frames and regulatory sequences for the polyprotein encoded by genome segment A were intact and should be functional. Transfection and Propagation of viruses in QM7 cells. Sequence analysis of the full-length clones with 318 mutations indicated these clones should be capable of generating viral particles using reverse genetics. Since the efficiency of the transfection may be only marginally adequate in BGM-70 cells, we tested QM7 cells which were previously used to successfully rescue IBDV using reverse genetics (1). Several concentrations of the transcription products and Lipofectamine 2000 were tested but using RT-PCR, no viral particles could be detected following transfection of these cells. Passage of the transfected cells in four-week-old SPF chicks also did not produce viral particles. The inability to rescue Del-E with a single Aspartic acid (D) Asparagine (N) mutation at position 318 or AR266 with a single Glycine (G) Asparagine (N) mutation at position 318 may be due to the loss of a critical function in VP2. Molecular epidemiologic studies revealed many IBDV strains with an Asparagine (N) at position 318 (9). After further review of the sequences from the viruses in that study, we observed that all the viruses with N318 also had a Glycine (G) Glutamic Acid (E) mutation at position 322. In a few cases the Glutamic Acid (E) mutation appeared at position 321 when Asparagine (N) was present at position 318. These data suggest that N318 may be a lethal mutation unless it is accompanied by Glutamic Acid (E) at position 321 or 322. Reverse genetic studies could be used to study this possibility but they were beyond the budget and scope of this project. 8

The N318 mutation and additional mutation at E321/E322 observed in our molecular epidemiology study (9, 13) may be a coincidence. However, monoclonal antibodies produced to this region of VP2 will neutralize the virus (4) suggesting that amino acids in this part of VP2 are critical to the replication of IBDV. It is logical to extend this result to include the possibility that an erroneous mutation in this region (N318) could also inhibit the replication of these viruses. Identification of naturally occurring IBDV mutants. The unsuccessful attempts to rescue IBDV strains with N318 mutations and the subsequent search for naturally occurring viruses with the N318 mutation led us to examine other isolates for point mutations in VP2. No viruses with a single mutation at 318 could be found. They all were accompanied by at least a second mutation at 321 or 322 and often by additional mutations in VP2. However, several isolates with point mutations at amino acid position 222 in the VP2 gene were found. The study of mutations at this amino acid is appropriate because a Proline Threonine change at 222 was critical to the antigenic drift that lead to the formation of variant viruses (5). Several viruses with a single mutation at position 222 in the hypervariable region of VP2 were selected for sequence analysis. We sequenced the entire genome segment A and found a virus designated Del-E-222 that was identical to Del-E except for an Alanine (A) at position 222. This was an interesting mutation because Alanine at 222 is typically seen in very virulent (vv) IBDV (18) however, this isolate from the United States was not a vvibdv strain. In vivo vaccination/challenge experiments. Serum samples collected from the SPF birds at hatch and prior to vaccination on day 10 were negative for IBDV antibodies using the virus-neutralization assay and ELISA (data not shown). The birds were vaccinated at 10 days of age and challenged at 21 days of age. All birds were euthanized 7 days following challenge. The bursa/body weight ratios and histopathologic lesion scores are shown in Table 2. Large bursas that appeared grossly normal were observed in the control Group1 and 89/03 vaccinated Group 2 birds. No microscopic lesions were observed in these bursa tissues (Table 2). The birds in these two groups were not challenged with virulent IBDV. Birds that were not vaccinated but were challenged with Del-E (Group 3), Del-E- 222 (Group 5) or Del-E-254 (Group 7) had small friable bursas. The bursa/body weight ratios calculated for these groups were significantly smaller than the controls (Groups 1 and 2). Microscopic lesions consisted of moderate depletion of lymphocytes, variable loss of follicles and reticuloendothelial cell proliferation with evidence of lymphocyte necrosis. No signs of hemorrhage or inflammation were observed. These results demonstrate that all three challenge viruses were capable of causing macroscopic and microscopic lesions in the bursa that are typically seen with variant viruses. Large normal appearing bursas were observed in Group 4 birds that had been vaccinated with 89/03 and subsequently challenged with the virulent Del-E virus. The bursa/body weight ratios were not significantly different among Groups 1, 2 and 4 which supports these macroscopic observations. No histopathologic lesions were observed in the bursa tissues from these birds. This was expected and demonstrates immunity resulting from the vaccine protected birds in Group 4 from the homologous Del-E challenge. 9

The bursas in birds that had been vaccinated with 89/03 and then challenged with Del-E-222 or Del-E-254 were macroscopically smaller than the controls but they were not friable. The bursa/body weight ratios of these bursas (Groups 6 and 8) were significantly smaller than the controls. They were similar to the bursa/body weight ratios observed when these challenge viruses were used in un-vaccinated birds (Groups 5 and 7). Microscopic lesions were similar to those seen in Groups 3, 5 and 7 although they appeared to be slightly less severe (Table 2). At the time of challenge, serology demonstrated the 89/03 vaccinated birds had neutralizing antibody titers and ELISA antibody titers albeit they were low (Table 3). Seven days following challenge these antibody titers had markedly increased (Table 3). Under these ideal and tightly controlled conditions, the data from the in vivo experiments demonstrate that immunity to the Del-E strain was insufficient to protect against a virus with a single amino acid mutation at position 222 (Del-E-222) or position 254 (Del-E-254). The data support our hypothesis that a relatively limited number of point mutations contribute to antigenic drift in IBDV. The results demonstrate that at least these two point mutations allowed the viruses to partially circumvent the active immunity produced by the 89/03 Del-E vaccine. This was a very basic vaccination/challenge study and was not designed to mimic field conditions. Had we vaccinated the birds with a different vaccine or a combination of vaccines (variant and classic) the results may have been different. Quasispecies have been demonstrated in IBDV vaccines and likely would broaden the immunity to IBDV challenge viruses (8). In these experiments, the 89/03 vaccine was propagated in BGM-70 cells and shown to have an identical amino acid sequence to Del-E except for two mutations (Q253H and A284T) necessary for growth in cell culture. Although we cannot completely rule out the possibility of quasispecies in this vaccine preparation, our sequence data suggest a majority of the viruses had the Del-E sequence across the hypervariable region of VP2. The 89/03 vaccine is widely used to protect against Del-E variant viruses. Our data support that it is efficacious against these viruses because it protected against the homologous Del-E strain. This result also indicates the mutations needed for this vaccine to replicate in cell culture did not alter its antigenic properties. Conclusions: Although full-length clones were prepared from IBDV strains that contained the desired point mutations in VP2, the rescue of these viruses using reverse genetics was not successful in all cases. The data suggest that point mutations at amino acid position 318 may inhibit replication of IBDV unless a complementary mutation at position 321 or 322 is present. Variant Del-E viruses with mutations at amino acids 222 and 254 in VP2 were tested for antigenic drift in vivo. The data indicate that these point mutations created a measurable antigenic change in Del-E that was detected in a tightly controlled vaccination/challenge study. The results support our hypothesis that a limited number of point mutations can contribute to antigenic drift in IBDV. It is possible that different amino acid mutations at these two positions would not have altered the antigenicity of Del-E. Furthermore, the 222 and 254 amino acid sites are probably not the only two that are contributing to antigenic drift among IBDV. Nevertheless, these studies aid in our 10

understanding of which VP2 amino acids affect the antigenicity of IBDV and contribute to antigenic drift. In the future, these data will help us understand how these viruses evolve and evade immunologic control efforts. 11

Table 1. Primers used to amplify and sequence genome segments A and B A. Primer Sequence 5 3 Direction 1 AGGATACGATGGGTCTGAC Forward 2 GCCCAGAGTCTACACCAT Forward 3 TACCGTTGTCCCATCAAAGC Reverse 4 GCAGGAGCATTCGGCTTC Forward 5 CCCGGATTATGTCTTTGA Reverse 6 GCCTTAGGTTGGCTGGTCCC Forward 7 CCACGTTGGCTGCTGC Reverse 8 AGGGGACCCGCGAACGGATCC Reverse 9 GGATACGATGGGTCTGACC Forward 10 CTTTGTAGCCGTTCTCTCTG Reverse 11 CGCACTACTCAAGCAGATG Forward 12 GTGGACTACCATATGTAGG Forward 13 ATACAGCAAAGATCTCGGG Forward 14 CAACACGGTCCAAGAACG Forward 15 GGGGGCCCCCGCAGGCG Reverse A Primers 1-8 were used for segment A sequences and primers 9-15 were used for segment B sequences. Their locations on each genome segment are shown in Figure 3. 12

Table 2. Bursa/body weight ratios of IBDV vaccinated and challenged SPF chicks. 1 Group 89/03 Vaccinated Del-E Challenge Del E-222 Challenge Del-E-254 Challenge Mean Bursa/body wt. ± SD 2 Histopathologic Lesion Score 3 1 - - - - 5.58 ± 1.16 a 0 2 + - - - 5.49 ± 0.91 a 0 3 - + - - 2.72 ± 0.78 b 2 4 + + - - 4.82 ± 0.92 a 0 5 - - + - 1.82 ± 0.59 b 3 6 + - + - 1.90 ± 0.48 b 2 7 - - - + 1.62 ± 0.24 b 3 8 + - - + 2.14 ± 0.31 b 2 1 Specific-pathogen-free chicks were vaccinated with the Del-E attenuated strain 89/03 at 10 days of age. Each bird received 10 3.0 EID 50 in 0.1 ml orally. At 21 days of age (11 days post vaccination) birds were challenged with Del-E, Del-E-222 or Del-E-254. Each bird challenged received 10 3.0 EID 50 in 0.1 ml orally. 2 The mean bursa/body weight rations ± standard deviations for 5 samples were calculated. Mean bursa/body weight ratios = bursa wt (g)/body wt (g) X 1000. Different superscript letters indicate statistically significant differences among the group means. 3 The severity of the microscopic lesions was graded based on the extent of the lymphocyte necrosis, follicular depletion and atrophy. Scores of 0 to 4 were used to indicate relative degree of severity, a score of 0 indicated absence of lesions, and scores 1 to 4 were for < 25%, 25 to 50%, 50 to 75% and >75% of follicles affected, respectively. 13

Table 3. Serology of IBDV vaccinated and challenged SPF chicks. 1 Group Treatment Virus Vaccine/Challenge 2 Neutralization 3 ELISA 4 1 Control < 100 <50 2 89/03/None 264 125 3 None/Del-E 3,763 7,769 4 89/03/Del-E 4,081 8,428 5 None/Del-E-222 4,579 7,852 6 89/03/Del-E-222 5,571 6,046 7 None/Del-E-254 8,163 6,646 8 89/03/Del-E-254 4,688 3,878 1 Birds were vaccinated at 10 days of age and challenged at 21 days of age. 2 Serum samples were collected prior to challenge on day 21 in groups 1 and 2 and at 7 days post-challenge in groups 3, 4, 5, 6, 7 and 8. 3 Virus neutralization titers are the geometric means of 5 samples. 4 The IBD-XR ELISA (IDEXX, Corp.) was used to assay the sera. Each serum sample was tested in duplicate. Each titer represents the geometric mean of 5 samples. 14

210 220 230 240 250 260 270 280 DelE AADNYQFSSQ YQTGGVTITL FSANIDAITS LSVGGELVFK TSVQSLVLGA TIYLIGFDGT AVITRAVAAN NGLTAGIDNL DelE_254...............N............ DelE_222.....A..................... 89/03_Vaccine...............H............T... 290 300 310 320 330 340 350 360 DelE MPFNLVIPTN EITQPITSIK LEIVTSKSDG QAGEQMSWSA SGSLAVTIHG GNYPGALRPV TLVAYERVAT GSVVTVAGVS DelE_254........................ DelE_222........................ 89/03_Vaccine........................ Figure 1. Amino acid sequences across the hypervariable region of VP2.

A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 cdna clone of genome segment A Plasmid pcr-xl-topo cdna clone of genome segment B B. 1 2 3 4 5 6 7 Purified cdna clone of genome segment A Purified cdna clone of genome segment B Figure 2. Gel electrophoresis of full-length IBDV cdna clones. A: cdna inserts excised from the pcr-xl-topo plasmid using EcoRI. A 100bp DNA size ladder is in lane 5. Uncut plasmid is in lane 14. B: Full-length IBDV cdna separated from the plasmid and ready for in vitro transcription. A 500bp DNA size ladder is in lane 3.

Genome Segment A 1 2 4 6 0 737 1446 2229 2318 1783 796 0 3 5 7 8 Genome Segment B 9 11 12 13 14 0 494 884 1839 2684 2536 0 10 15 Figure 3. Location of primers used to sequence the full-length IBDV clones. 17

REFERENCES 1. Boot, H. J., K. Dokic, and B. Peeters. Comparison of RNA and cdna transfection methods for rescue of infectious bursal disease virus. Journal of Virological Methods 97:67-76, 2001. 2. Brandt, M., K. Yao, M. Liu, R. A. Heckert, and V. N. Vakharia. Molecular determinants of virulence, cell trophism, and pathogenic phenotype of infectious bursal disease virus. Journal of Virology 75:11974-11982, 2001. 3. Dahling, D. R. and B. A. Wright. Optimization of the BGM cell line culture and viral assay procedures for monitoring viruses in the environment.. Applied and Environmental Microbiology 51:790-812, 1986. 4. Eterradossi, N., D. Toquin, G. Rivallan, and M. Guittet. Modified activity of a VP2- located neutralizing epitope on various vaccine, pathogenic and hypervirulent strains of infectious bursal disease virus. Archives of Virology 142:255-270, 1997. 5. Heine, H. G., M. Haritou, P. Failla, K. Fahey, and A. A. Azad. Sequence analysis and expression of the host-protective immunogen VP2 of a variant strain of infectious bursal disease virus which can circumvent vaccination with standard type I strains. Journal of General Virology 72:1835-1843, 1991. 6. Jackwood, D. H., Y. M. Saif, and J. H. Hughes. Replication of Infectious Bursal Disease Virus in Continuous Cell Lines. Avian Diseases 31:370-375, 1986. 7. Jackwood, D. J. and S. E. Sommer. Restriction fragment length polymorphisms in the VP2 gene of infectious bursal diseases viruses. Avian Diseases 41:627-637, 1997. 8. Jackwood, D. J. and S. E. Sommer. Identification of Infectious Bursal Disease Virus Quasispecies in Commercial Vaccines and Field Isolates of This Double-Stranded RNA Virus. Vir 304:105-113, 2002. 9. Jackwood, D. J. and S. E. Sommer-Wagner. Molecular epidemiology of infectious bursal disease viruses: Distribution and genetic analysis of newly emerging viruses in the United States.. Avian Diseases 49:220-226, 2005. 18

10. Jackwood, D. J., B. Sreedevi, L. J. LeFever, and S. E. Sommer-Wagner. Studies on naturally occurring infectious bursal disease viruses suggest that a single amino acid substitution at position 253 in VP2 increases pathogenicity. Virology 377:110-116, 2008. 11. Knoblich, H. V., S. E. Sommer, and D. J. Jackwood. Antibody titers to Infectious Bursal Disease Virus in Broiler Chicks After Vaccination at One Day of Age with Infectious Bursal Disease Virus and Marek's Disease Virus. Avian Diseases 44:874-884, 2000. 12. Lim, B. L., Y. Cao, T. Yu, and C. W. Mo. Adaptation of very virulent Infectious Bursal Disease Virus to chicken embryonic fibroblasts by site-directed mutagenesis of residues 279 and 284 of viral coat protein VP2. Journal of Virology 73:2854-2862, 1999. 13. Mickael, C. S. and D. J. Jackwood. Real-time RT-PCR analysis of two epitope regions encoded by the VP2 gene of infectious bursal disease viruses.. Journal of Virological Methods 128:37-46, 2005. 14. Mundt, E.Tissue culture infectivity of different strains of infectious bursal disease virus is determined by distinct amino acids in VP2. Journal of General Virology 80:2067-2076, 1999. 15. Mundt, E. and V. N. Vakharia. Synthetic transcripts of double-stranded Birnavirus genome are infectious. Proc.Natl.Acad.Sci.USA 93:11131-11136, 1996. 16. Schnitzler, D., F. Bernstein, H. Muller, and H. Becht. The genetic basis for the antigenicity of the VP2 protein of the infectious bursal disease virus. Journal of General Virology 74:1563-1571, 1993. 17. Sreedevi, B., L. J. LeFever, S. E. Sommer-Wagner, and D. J. Jackwood. Characterization of Infectious Bursal Disease Viruses from Four Layer Flocks in the United States. Avian Diseases 51:000-000, 2007. 18. Van Den Berg, T. P.Acute infectious bursal disease in poultry: a review. Avian Pathology 29:175-194, 2000. 19

LIST OF PRESENTATIONS AND PUBLICATION The work conducted for Objective 1 included very basic molecular experiments which were not publishable as a standalone study. Nevertheless, the work conducted on this project provided some information that was used in publications and presentations related to genetic characterization and point mutations in the VP2 of IBDV. The results generated for Objective 2 are potentially publishable and since this part of the project was recently completed, that manuscript is in preparation. Jackwood, D. J. and S. E. Sommer-Wagner. Point mutations in the hypervariable region of VP2 cause a measurable antigenic drift in the Del-E variant infectious bursal disease virus. (In Preparation) 2010. Presentations that resulted in part by the studies conducted for this project. Peer reviewed publications: Sreedevi, B., L. J. LeFever, S. E. Sommer-Wagner, and D. J. Jackwood. Characterization of infectious bursal disease viruses from four layer flocks in the United States. Avian Dis. 51:845-850. 2007. Jackwood., D. J., B. Sreedevi, L. J. LeFever, S. E. Sommer-Wagner. Studies on naturally occurring infectious bursal disease viruses suggest that a single amino acid substitution at position 253 in VP2 increases pathogenicity. Virology 377:110-116, 2008. Abstracts and presentations: Jackwood, D. J., B. Sreedevi, L. J. LeFever and S. E. Sommer-Wagner. Evaluation of the pathogenicity of infectious bursal disease viruses from layer flocks in the United States. Abstr. 63, 144 th AVMA meet. 2007. Jackwood, D. J., B. Sreedevei, L. J. LeFever and S. E. Sommer-Wagner. Point mutations that affect pathogenicity in classic infectious bursal disease virus. Abstr. 145 th AVMA meet. 2008. Jackwood, D. J. and S. E. Sommer-Wagner. Isoleucine at position 451 is not critical for pep46 activity in infectious bursal disease viruses. Abstr. #51, 155 th AVMA meet. 2009. Jackwood, D. J. Current status of infectious bursal disease. Keynote Speaker. Proceedings of the XXXIV Annual Asociacion Nacional de Especialistas en Ciencias Avicolas de Mexico, A. C. (ANECA) Convention. Acapulco, Mexico. August 2009. 20