About OMICS Group Conferences

Similar documents
About OMICS Group Conferences

About OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa

About OMICS Group Conferences

About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and

About OMICS International Conferences

About OMICS Group Conferences

2/12/2014 *** + Chloro + Chloro. Bruce Ito, Nandini Ravindran, Robert Mentzer, unpublished data

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

About OMICS International Conferences

OMICS International Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007

About OMICS Group Conferences

About OMICS International Conferences

OMICS International Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

OMICS Group International is an amalgamation of Open Access publications

OMICS International Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

About OMICS Group Conferences

About OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS

About OMICS Group. Prof Dr. Abdalla Omar

About OMICS Group Conferences

OMICS INTERNATIONAL CONFERENCES

About OMICS Group Conferences

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

About OMICS International Conferences

About OMICS Group Conferences

ABOUT OMICS INTERNATIONAL CONFERENCES

OMICS Journals are Welcoming Submissions

About OMICS International Conferences

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan

Supplemental Figures:

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease

Repetitive stimulation of autophagy-lysosome machinery by intermittent fasting preconditions the myocardium to ischemia-reperfusion injury

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Nilgün Gedik 1, Matthias Thielmann 2, Eva Kottenberg 3,Jürgen Peters 3, Heinz Jakob 2, Gerd Heusch 1, Petra Kleinbongard 1 * Abstract.

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

OVERVIEW OF ADVERSE CARDIOVASCULAR EVENTS IN THE BRODALUMAB PSORIASIS STUDIES

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Assessing Cardiac Risk in Noncardiac Surgery. Murali Sivarajan, M.D. Professor University of Washington Seattle, Washington

About OMICS Group Conferences

Hypothalamic Autophagy and Regulation of Energy Balance

Metformin For Prevention of Type II Diabetes

Integrative cardiovascular physiology: a primer to hypothesis driven research

A. Generation and characterization of Ras-expressing autophagycompetent

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Cardiovascular Diseases (BMM9) and Getting to Know CNIC course Course

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with

About OMICS International

Implications of The LookAHEAD Trial: Is Weight Loss Beneficial for Patients with Diabetes?

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

SUPPLEMENTARY INFORMATION In format provided by JAATTELA (NOVEMBER 2005)

Cardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century October 4, 2010

Basic pathophysiology of recovery: the role of endocrine metabolic response. Franco Carli McGill University Montreal, Canada

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Autoimmunity. Autoimmunity Brochure. International Conference on. Autoimmunity Manchester, UK October 13-14, 2016

Cardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009

Main Results Insulin Resistance Intervention after Stroke (IRIS) Trial

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

SUPPLEMENTARY INFORMATION

Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study

Useful? Definition of High-risk? Pre-OP/Intra-OP/Post-OP? Complication vs Benefit? Mortality? Morbidity?

Ischemic Heart Disease Interventional Treatment

The Journal of Thoracic and Cardiovascular Surgery

Supplementary Figure S1 Supplementary Figure S2

Andrew Cohen, MD and Neil S. Skolnik, MD INTRODUCTION

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Models of preventive care in clinical practice to achieve 25 by 25

Successful completion of Phase I clinical trial of AMPK activator O304

Association between arterial stiffness and cardiovascular risk factors in a pediatric population

Cardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016

Supplementary Figure 1

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Cardioprotezione ed invecchiamento

Cardiovascular Update for the Primary Care Provider. Friday, June 12, 2015 Seattle

Cardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo

Ischemic Heart Disease Interventional Treatment

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified


Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24

Pathophysiology of ischemia-reperfusion injury (and how to protect against it )

A nationwide population-based study. Pai-Feng Hsu M.D. Shao-Yuan Chuang PhD

Autophagy as a therapeutic target for ischaemia/reperfusion injury? Concepts, controversies, and challenges

Transcription:

About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS Group publishes 400 online open access scholarly journals in all aspects of Science, Engineering, Management and Technology journals. OMICS Group has been instrumental in taking the knowledge on Science & technology to the doorsteps of ordinary men and women. Research Scholars, Students, Libraries, Educational Institutions, Research centers and the industry are main stakeholders that benefitted greatly from this knowledge dissemination. OMICS Group also organizes 300 International conferences annually across the globe, where knowledge transfer takes place through debates, round table discussions, poster presentations, workshops, symposia and exhibitions.

About OMICS Group Conferences OMICS Group International is a pioneer and leading science event organizer, which publishes around 400 open access journals and conducts over 300 Medical, Clinical, Engineering, Life Sciences, Pharma scientific conferences all over the globe annually with the support of more than 1000 scientific associations and 30,000 editorial board members and 3.5 million followers to its credit. OMICS Group has organized 500 conferences, workshops and national symposiums across the major cities including San Francisco, Las Vegas, San Antonio, Omaha, Orlando, Raleigh, Santa Clara, Chicago, Philadelphia, Baltimore, United Kingdom, Valencia, Dubai, Beijing, Hyderabad, Bengaluru and Mumbai.

The Homeostatic Intracellular Repair Response (HIR 2 ) And Heart Surgery 3 rd International Conference on Clinical and Experimental Cardiology Hilton Chicago, Northbrook, USA, 2013 Bruce R. Ito, Roberta A. Gottlieb, Robert M. Mentzer, Jr. Donald P. Shiley BioScience Center San Diego State University San Diego, CA School of Medicine/WSU CVRI Wayne State University Detroit, MI

The Homeostatic Intracellular Repair Response (HIR 2 ) HIR 2 is a lysosomal adaptive response to stress Preclinical evidence indicates it is manifest in multiple organs In the heart it is a protective response to ischemia-reperfusion

Autophagy: A Survival Pathway Mitochondrion Pre-autophagosomal structure Atg5-Atg12 Beclin-1 Phagophore p62 Autophagolysosome LC3 Autophagosome Lysosome Modified from T. Shintani et al., Science 306, 990-995 (2004)

Central Hypothesis Autophagy is impaired in the setting of MetS and results in the loss of endogenous protection conferred by ischemic preconditioning (IPC)

Metabolic Syndrome (MetS) Characterized by obesity, HC, dyslipidemia, and insulin resistance Increased risk of death from myocardial infarction and stroke Prevalence in the USA estimated at >30% of the population; >20% Japan (and rapidly increasing)

Methods Utilized 3 translational models of MetS LC3-mCherry transgenic mice fed a high fat diet (HFD) Genetic Zucker obese (ZO) rats Yucatan pigs fed a high fat/high fructose diet (HF/HF) Assessed autophagy (puncta, Western blot) Measured infarct size (TTC) and response to ischemic preconditioning (IPC)

Body Weight Gain (g) Fewer Cardiac Autophagosomes 14 12 10 8 6 4 2 0 MHC mcherry-lc3 Mice Control Diet HFD 0 20 40 60 80 100 120 Days on Diet in DIO Mice Normal Chow 40x High Fat Diet 40x Puncta/ Field 400 300 200 100 Number of Puncta n=7 * n=7 Puncta / Nuclei 5 4 3 2 1 Puncta/ Nuclei n=7 * n=7 Puncta Size (px 2 ) 250 200 150 100 50 mcherry LC3 Puncta Size 60x 0 Chow HFD 0 Chow HFD 0 M14 M15 M16 M6 M7 Chow Diet M8 High Fat Diet

Autophagy is Decreased in DIO Mice p62 LC3 Chow HFD 14 LC3-II 5 Beclin-1 LC3II (Density) 12 10 8 6 4 2 Beclin-1/ GAPDH 4 3 2 1 0 Chow HFD 0 Chow HFD Atg12 2.5 p62 2.0 Atg12/ Tubulin 2.0 1.5 1.0 p62/ Actin 1.5 1.0 0.5 0.5 Chow HFD 0.0 Chow HFD

MetS in Zucker Obese Rats Body Weight (g) 600 500 400 300 200 Body Weight p < 0.01 Lean Obese Cholesterol (mg/dl) 250 200 150 100 50 0 Serum Cholesterol p < 0.01 Lean Obese Triglyceride (mg/dl) 800 600 400 200 0 Serum Triglycerides p < 0.01 Lean Obese HOMA Index 300 250 200 150 100 50 0 HOMA p < 0.01 Lean Obese Blood Glucose (mg/dl) 140 120 100 80 60 Fasting Glucose p < 0.01 Lean Obese Insulin (ng/ml) 40 30 20 10 0 Serum Insulin p < 0.01 Lean Obese

Impaired Autophagy in Adult Myocytes from ZO Rats with MetS 350 LC3-II: Starvation LC3-II (% of Control) 300 250 200 150 100 50 Lean Control Starved ZO LC3 Rho Lean Ctrl Lean Starve ZO Ctrl ZO Starve p-s6k (% of Control) 140 120 100 80 60 40 20 0 p-s6k: Rapamycin Lean Control Rapamycin ZO LC3-II (% of Control) 160 140 120 100 80 60 LC3-II: Rapamycin Lean Control Rapamycin ZO p62 (% of Control) 140 120 100 80 60 p62: Rapamycin Control Rapamycin Lean ZO 12

Autophagy is Reduced in in ZO Rats with MetS 0.12 Cardiac LC3-II 0.35 Cardiac Atg 5 0.10 0.30 Density 0.08 0.06 Density 0.25 0.20 0.04 0.15 0.02 0.10 LC3 Lean Obese

Impaired Pre-conditioning in Zucker Obese Rats with MetS Lean Cont. Lean IPC Obese Cont. Obese IPC 80 Infarct Size in Zucker Rats Infarct Size (% AAR) 60 40 20 * N.S. 0 Cont. IPC Cont. IPC Lean Obese

Obesity and Hypercholesterolemia in High Fat/ Fructose Fed Yucatan Pigs Body Weight (kg) 40 35 30 25 20 15 10 Yucatan Mini Pigs Body Weight HFFD Diet Chow Diet 0 1 2 3 4 5 6 7 8 9 Time on Diet (Weeks) Cholesterol (mg/dl) 1400 1200 1000 800 600 400 200 0 Fasting Cholesterol HFFD Diet Chow Diet 0 1 2 3 4 5 6 7 Time on Diet (Weeks) 100 Abdominal Girth 25 Calculated Body Fat 90 20 (cm) 80 70 (%) 15 10 60 5 50 Chow HFFD 0 Chow HFFD

Depressed Autophagy in Obese Yucatan Pigs Atg5 Rho p62 Rho Chow HFD Chow HFD 1.2 Cardiac Atg5 2.5 Cardiac p62 1.0 2.0 Atg5/ Rho 0.8 0.6 0.4 p62/ Rho 1.5 1.0 0.2 0.5 0.0 Chow HFFD 0.0 Chow HFFD

Impaired Preconditioning in Obese Swine with MetS Effect of High Fat - High Fructose Diet on Ischemic Preconditioning (IPC 1 x10') in Pigs Infarct Size (% of AAR) 60 50 40 30 20 10 0 n=6 No IPC n=2 IPC Lean Farm Pigs n=2 Lean IPC n=2 HFFD IPC Yucatan Mini-pigs

Summary Animal models of metabolic syndrome show impaired autophagy and loss of cardioprotection But do we know about autophagy and cardioprotection in the human heart?

Autophagy in the Human Heart Upregulated autophagy in failing heart decreased after mechanical unloading Kassiotis et al. Circulation 2009 Impaired autophagy associated with postoperative atrial fibrillation Garcia et al. J Thorac Cardiovasc Surg 2011

Methods (1) 19 patients (38 samples) undergoing cardiac surgery Right atrial tissue (200-400 mg) obtained before cross-clamping the aorta and after its removal Western blotting used to measure autophagy proteins (Beclin-1, Atg5-12, SQSTM1/p62)

Methods (2) The perioperative autophagic response was correlated with the morbidity and mortality risk calculated from STS Adult Cardiac Surgery Database

Actin Levels Are Unaffected By 0.8 Cardiac Stress 0.6 Actin 0.4 N.S. 0.2 0.0 Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Actin

Cardiac Stress Is Associated with Decreased Levels of Beclin -1 Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Beclin-1

Cardiac Stress Is Associated with Decreased Levels of Atg5-12 1.0 0.8 Atg5-12 0.6 0.4 p = 0.002 0.2 0.0 Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Atg5-12

Cardiac Stress Is Associated with 0.5 Decreased Levels of p62 0.4 p62 0.3 0.2 p = 0.001 0.1 0.0 Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b P62/SQSTM1

Cardiac Stress Depletes Key Autophagy Proteins Signal Density 0.6 0.5 0.4 0.3 0.2 0.1 n =19 Patients Beclin-1 Atg 5-12 p62 p = 0.001 * p =0.002 * p = 0.001 * 0.0 Before After Before After Before After

Operative Risk Correlates with Changes in Autophagy Morbidity/ Mortality Risk (%) 30 25 20 15 10 5 0 r 2 = 0.30 p = 0.027-0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Change in p62 (Density Units)

Summary Preclinical studies support concept that autophagy is cardioprotective and is impaired in MetS Cardiac surgery and its attendant ischemia is accompanied by accelerated autophagic flux The magnitude of flux increase is inversely correlated with risk

Conclusion Studies evaluating the role of autophagy in setting of I/R are feasible in humans Enhancement of autophagy represents a new clinical approach to myocardial protection during heart surgery

Preparing for OMICS 2013

Acknowledgements Bruce R. Ito Roberta A. Gottlieb Salik Jahania David Sengstock Peter Vaitkevicius Post-doctoral Fellows Zoltan Giricz Allen Andres Students Nandini Ravindran Carlos Bazan 31

Mechanism is Adaptive Autophagy Mitochondrion Atg5-Atg12 p62 Beclin-1 LC3-GFP Modified from T. Shintani et al., Science 306, 990-995 (2004)

Conclusion The findings suggest that the future of better cardioprotection lies with our ability to enhance this important adaptive response to ischemic stress

The Homeostatic Intracellular Repair Response (HIR 2 ) HIR 2 is a lysosomal adaptive response to stress Represents a new approach to myocardial protection Preclinical evidence indicates it is manifest in multiple organs and is cardioprotective

Increased Autophagic Flux is Associated with Reduced M/M Risk Autophagy Proteins Calculated M/M Risk vs. p62 Signal Density 0.6 0.5 0.4 0.3 0.2 0.1 0.0 n =19 Patients Beclin-1 Atg 5-12 p62 p = 0.001 * p =0.002 Before After Before After Before After * p = 0.001 * Morbidity/ Mortality Risk (%) 30 25 20 15 10 5 r 2 = 0.30 p < 0.03 0-0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Change in p62 (Density Units)

Summary Autophagy flux is inversely correlated with operative risk Autophagy in humans is an endogenous self protective response

Thanks' for your kind attention!!!!!! 38

Let Us Meet Again We welcome you all to our future conferences of OMICS Group International Please Visit: www.omicsgroup.com www.conferenceseries.com http://cardiology.conferenceseries.com/