Supplemental information

Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman Hachani, Maria A. Whitehead, Wayne P. Pearce, Inma Berenjeno Martin, Gemma Nock, Alain Filloux, Rudi Beyaert, Veronique Flamand & Bart Vanhaeseroeck Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 1 p11δ PI3K compartmentalizes intracellular TLR4 signaling

WB: δ(d91a) δ(d91a) δ(d91a) c δ(d91a) p11α 4 6 6 p11β p11δ p11γ p85 tuulin BMDC SDC cell numer (1 7 ) 3 2 1 BMDC cell numer (1 6 ) 4 2 SDC % of total splenocytes 4 2 CD8a CD8a + e cells cells cells Counts 12 9 Counts 6 3 3 1 11 12 13 14 1 11 12 13 14 FL 2 Log FL 2 Log IA-IE IA-IE 7 7 525 525 35 35 175 175 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 CD4 FL 1 Log CD4 FL 1 Log 15 15 Counts Counts 12 9 6 1 5 δ(d91a) 1 5 Ctrl A Med LPS Tlr4 +/ Med LPS f uptake (MFI) 2 15 1 5 δ(d91a) 1 1 1 1 2 1 3 1 4 TLR4 FL 2 Log 1 1 1 1 2 1 3 1 4 FL 2 Log TLR4-MD2 Supplementary Figure 1: Inactivation of the p11δ isoform of PI3K does not affect DC differentiation. (a) Unaltered PI3K isoform expression in δ(d91a) BMDCs and SDCs, as assessed y immunolotting of total cell lysates with the indicated antiodies. One representative experiment is shown, n=3. () Unaltered numers of BMDCs and SDCs in δ(d91a) mutant mice. The numer of BMDCs was quantified y trypan lue exclusion and flow cytometry analysis for CD11c staining. SDCs were quantified immediately after isolation from the spleens y magnetic eads coated with a CD11c antiody. Data are the mean s.d. of cell numers (n=5, per mice strain). (c) Unaltered SDC differentiation in δ(d91a) mice. CD11c and CD8α surface expression in the spleens was analyzed y FACS. Data are mean s.d. of MFI (n=4-5, per mice strain). (d) Unaffected LPS-induced phenotypic maturation and TLR4 internalization in δ(d91a) BMDCs. The expression of surface markers on BMDCs was analyzed y flow cytometry after LPS (1 ng/ml) stimulation for 24 h. Data are one representative experiment, n=5. (e) p11δ lipid kinase activity is required for transferrin uptake, ut not for FcγR-mediated phagocytosis. The uptake of IgG-coated E. coli io-particles, FITC-dextran and FITC-transferrin y BMDCs from the indicated mouse strain efore and after LPS stimulation (1 ng/ml) was assessed y flow cytometry. Results are the mean+s.d. of MFI of triplicate stimulations of three to four experiments. P <.1 y Student s t-test. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 2 p11δ PI3K compartmentalizes intracellular TLR4 signaling

DIC F-actin PtdIns(3,4,5)P 3 Merge Med δ(d91a) δ D91A LPS δ(d91a) %cells with PIP 3 at the PM 8 6 4 2 LPS (min) : 1 Supplementary Figure 2: p11δ generates PtdIns(3,4,5)P 3 in BMDC cells. Confocal micrographs of BMDCs, untreated or stimulated with LPS (1 ng/ml) for 1 min, were stained for PtdIns(3,4,5)P 3 and F-actin. The arrows indicate PtdIns(3,4,5)P 3 -enriched areas at the plasma memrane. The graphs on the right panel are mean s.d. of % BMDCs with PtdIns(3,4,5)P 3 -positive staining at the plasma memrane, assessed y DIC/F-actin overlay from 45-5 cells, collected from at least 1 fields (n = 3 per mice strain) after analyzed y ImageJ. P <.5 or P <.5 y Student s t-test. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 3 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Med LPS (1 min) TIRAP EEA1 δ(d91a) Supplementary Figure 3: TIRAP does not localize to the early endosomes. Confocal micrographs show TIRAP and EEA1 staining in BMDCs, stimulated or not with LPS (1 ng/ml) for 1 min. The arrows indicate TIRAP-staining at the periphery. One representative of at least 5 similar micrographs collected from 3 independent experiments is shown. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 4 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Binding (A..45 nm ).8.6.5.3.2 PtdIns PtdIns(3)P PtdIns(4)P PtdIns(5)P PtdIns(3,4)P 2 PtdIns(3,5)P 2 PtdIns(4,5)P 2 PtdIns(3,4,5)P 3. TIRAP PLCδ-PH Akt-PH Hrs-FYVE GST-TIRAP c GST-TIRAP PIP2 inding (fold) 2.5 2. 1.5 1..5 GST-PLCδ-PH PIP2 inding (A.45 nm) 2. 1.5 1..5 GST-TIRAP-4X 2.5 5. 7.5 PIP 2 (% mol) 1 1 1 1 1 1 protein concentration log (pm) Supplementary Figure 4: TIRAP inds to PtdIns(4,5)P 2. (a) Phospholipid inding profile of GST- TIRAP. Reference proteins with known phospholipid preference were as follows: GST-PLCδ-PH (PtdIns(4,5)P 2 ), GST-Akt-PH (PtdIns(3,4,5)P 3 ) and GST-HRS-FYVE (PtdIns(3)P). () GST-TIRAP and GST-PLCδ-PH inding to PtdIns(4,5)P 2 in a lipid vesicle association assay. (c) PtdIns(4,5)P 2 - inding of GST-TIRAP and GST-TIRAP-4X in a PtdIns(4,5)P 2 -coated plate inding assay. Data are the mean sem of one out of three experiments, performed in triplicate (a,, and c). Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 5 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Myc p11δ parental vector 5 Myc-p11δ 5 Myc-p11δ-3 CAAX Vector p11δ PtdIns(3,4,5)P 3 F-actin Merge p-akt(s473) Akt p11δ-caax TIRAP c PtdIns(4,5)P 2 TIRAP F-actin Merge Vector p11δ-caax Supplementary Figure 5: Constitutively active p11δ decreases memrane localization and expression levels of endogenous TIRAP. (a) Immunolotting for Myc, p11δ, p-akt(s473), TIRAP and GAPDH in NIH3T3 cells staly expressing pmx (empty vector), pmx-p11δ or pmx-p11δ- CAAX. () Confocal micrographs of p11δ, PtdIns(3,4,5)P 3 and F-actin staining in NIH3T3 cells staly expressing pmx (empty vector) or pmx-p11δ-caax. The cells were stained with phalloidin (F-actin) or antiodies directed against p11δ. Images are representative of at least 4-5 similar micrographs collected from 3 independent experiments performed on the indicated cell line. (c) Confocal micrographs of PtdIns(4,5)P 2, TIRAP and F-actin staining in NIH3T3 cells staly pmx (empty vector) or pmx-p11δ-caax. The cells were stained with phalloidin or antiodies to PtdIns(4,5)P 2 (2C11) or TIRAP. All images are representative of at least 4-5 similar micrographs collected from 3 independent experiments. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 6 p11δ PI3K compartmentalizes intracellular TLR4 signaling

TIRAP (kda) 37 α-tuulin 5 LPS (h):.5 1.5 1.5 1.5 1.5 1.5 1.5 1 TIRAP Veh N-ALLN MG-132 IC87114 (kda) 37 GAPDH 32 LPS (h):.5 1 2.5 1 2.5 1 2.5 1 2 Supplementary Figure 6: The effects of pharmacological inhiitors on the kinetics of TIRAP degradation following LPS activation. (a) BMDCs were pretreated for 1 h with IC87114 (1 μm), U373122 (5 μm), Dynasore (5 μm), N-ALLN (5 μm), MG-132 (1 μm) or vehicle (Veh) for 1 h efore stimulation with LPS (1 ng/ml) for the indicated times. Total cell lysates were analyzed y immunolotting using antiodies to TIRAP or α-tuulin. Dotted lines indicate the cropped lanes from immunolots, which were simultaneously analyzed from the lysates that were prepared under the same conditions. Results shown are one representative of three independent analyses per group. () J774 cells were pretreated with N-ALLN (5 µm), MG-132 (1 μm), IC87114 (1 μm) or vehicle for 1 h, stimulated with LPS (1 ng/ml) for the indicated times Vertical dotted lines indicate the end of the first immunolot and the eginning of the second one, performed and analyzed as in (a). The results are one representative of three such analyses. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 7 p11δ PI3K compartmentalizes intracellular TLR4 signaling

p11α flox/flox p11α del/del p11β flox/flox p11β del/del 8 5 TNF ng/ml 6 4 2 TNF ng/ml 4 3 2 1 LPS (µg/ml) :.1.1 1. LPS (µg/ml) :.1.1 1. p11α flox/flox p11β flox/flox p11α del/del p11β del/del 1.2.8 IFN-β ng/ml.8.4 IFN-β ng/ml.6.4.2 LPS (µg/ml) :.1.1 1. LPS (µg/ml) :.1.1 1. Supplementary Figure 7: p11α and p11β are not involved in LPS-induced cytokine production in BMDCs. BMDCs were generated as descried in Methods. On day 12, BMDCs from the indicated mouse strains were stimulated with LPS (1 ng/ml) for 24 h, followed y determination of the levels of (a) TNF and () IFN-β in the culture supernatant. Data are the mean s.d. of cytokine levels in cells from 3-5 mice per group. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 8 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Pten +/ 25 2 15 1 5 LPS (.1 µg) + + TNF (ng/ml) LPS (1. µg/ml) + + IC87114 (1 µm) + +.8.6.4.2 LPS (.1 µg) IFN-β (ng/ml) Pten +/ u u + + LPS (1. µg) + + IC87114 (1 µm) + + Supplementary Figure 8: Loss of PTEN expression downregulates the induction of proinflammatory cytokines and enhances type I IFN-β production. Levels of (a) TNF and () IFN-β in culture supernatant otained from or Pten +/- BMDCs that were pretreated with vehicle (DMSO) or IC87114 (1 µm), followed y LPS stimulation as indicated. Data are one representative of two experiments of the mean s.d. of cytokine levels in cells from 3 different mice per group. P <.5 (Mann-Whitney U test). Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 9 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Supplementary Tale 1. IC 5 values of various PI3K inhiitors in vitro. IC 5 (μm) Inhiitor p11α p11β p11δ p11γ PI-13.8.88.48.15 TGX-221 5..5.1 3.5 IC87114 >1 1.82.7 1.24 AS6524.6.27.3.8 GDC-941.3.33.3.75 Wortmannin.1.2.1.1 LY2942.7.36 1.33 7.26 Note that in vitro IC 5 values using intact cells are 1 to 1 times higher 14. Data were compiled from pulished work: PI-13 15, TGX-221 16 and GDC-941 17. Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 1 p11δ PI3K compartmentalizes intracellular TLR4 signaling

Supplementary Tale 2. List of primers used for assessment of mrna aundance. IFN-β Forward TGACGGAGAAGATGCAGAAG Reverse TCCAGGAGACGTACAACAATAGTC Proe TGCCTTTGCCATCCAAGAGATGC Hprt1 IL-1β IL-6 IL-1 TNF Forward GGACCTCTCGAAGTGTTGGAT Reverse CCAACAACAAACTTGTCTGGAA Proe CAGGCCAGACTTTGTTGGATTTGAA Forward primer TTGACGGACCCCAAAAGATGAAGGG Reverse primer TCCACAGCCACAATGAGTGATACTG Proe CTGCTTCCAAACCTTTGACCTG Forward GAGGATACCACTCCCAACAGACC Reverse AAGTGCATCATCGTTGTTCATACA Proe CAGAATTGCCATTGCACAACTCTTTTCTCA Forward primer GCCACATGCTCCTAGAGCTG Reverse primer CAGCTGGTCCTTTGTTTGAAA Proe CGGACTGCCTTCAGCCAGGTG Forward primer CAGACCCTCACACTCAGATCA Reverse primer CACTTGGTGGTTTGCTACGA Proe TCGAGTGACAAGCCTGTAGCCCA Nature Immunology: doi:1.138/ni.2426 Aksoy et. al. 11 p11δ PI3K compartmentalizes intracellular TLR4 signaling