Imtiyaz et al., Fig. S1

Similar documents
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supporting Information Table of Contents

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Supplementary Figure 1

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

SUPPLEMENTARY INFORMATION doi: /nature12026

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15

SUPPLEMENTARY INFORMATION

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Nature Immunology doi: /ni.3268

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

Nature Immunology: doi: /ni.3412

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Quantitative PPARγ expression affects the balance between tolerance and immunity

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Supplementary material page 1/10

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type

Plasma exposure levels from individual mice 4 hours post IP administration at the

Effective Targeting of Quiescent Chronic Myelogenous

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

SUPPLEMENTARY METHODS

Supplemental Table 1. Primer sequences for transcript analysis

Nature Genetics: doi: /ng.3812

The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice

Supplementary Figures

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

SUPPLEMENTARY INFORMATION

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

SUPPLEMENTARY INFORMATION

Aquaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Nature Genetics: doi: /ng Supplementary Figure 1

effect on the upregulation of these cell surface markers. The mean peak fluorescence intensity

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Supplementary Materials for

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

Molecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D.

Hosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information)

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Nature Neuroscience: doi: /nn Supplementary Figure 1

Granulocyte and lymphocyte proteins

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.

Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Chronic variable stress activates hematopoietic stem cells

Supporting Information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Expanded View Figures

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplementary. presence of the. (c) mrna expression. Error. in naive or

SUPPLEMENTARY INFORMATION

pplementary Figur Supplementary Figure 1. a.

NK cell flow cytometric assay In vivo DC viability and migration assay

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Transfer protocol of human HSC into NOG mice

Nature Immunology: doi: /ni.3866

T cell development October 28, Dan Stetson

SUPPLEMENTARY INFORMATION

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

Supporting Information

SUPPLEMENTARY INFORMATION

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

Supplemental Information. IRF-5 Promotes Cell Death in CD4 T Cells. during Chronic Infection

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Kerdiles et al - Figure S1

Transcription:

. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are not dependent on HIF-α. () Myeloid progenitors are not influenced by HIF-α. The IL-7Rα - Lin - Sca-1 - c-kit + fraction (gated, top panel) was subdivided into MPs (FγRII/III lo D3 + ), GMPs (FγRII/III hi D3 + ), and MEPs (FγRII/III lo/- D3 - ) based on their D3 and FγRII/III expression. Representative panels of FS analyses are shown. () Normal proliferation of Hif- α MDMs. MDMs treated with normoxia (1% O ) and hypoxia (3.% O ) and their proliferation was determined by counting cell numbers every two days for eight days. () Normal survival of Hif-α MDMs. MDMs were placed under normoxia (1% O ) and hypoxia (.5% O ) and their viability was analyzed by propidium iodide uptake assay.

Imtiyaz et al., Fig. S 1. 1. 1. 1. 1..... 1. 1..... TP : - + - + 1 TP : - + - + D TP : - + - + E N TP H H+TP F M Spleen P.9 3.1 1. 1.5 3. 5. D11b Supplemental Figure S. Neuthophils do not express HIF-α. () Expression of HIF-1α and HIF-α in bone marrowderived mouse neutrophils was evaluated at normoxia and relative mrn levels were normalized to that of endogenous HPRT1. () HIF-α protein stabilization in bone marrow-derived mouse neutrophils was compared to that in MDMs exposed to hypoxia for 3hrs. n.s.: non-specific band as a loading control. () MPRO cells were differentiated for 3 days in the presence of R (1 µm). HIF-α and HIF-1α mrn level was determined by QRT-PR following the stimulation with TP (1 ) for 15 min. (D) HIF-α protein level in MPRO cells was evaluated by Western blotting following TP treatment. (E) Surface expression of D11b on MPRO cells was analyzed by flow cytometry following TP treatment. (F) Normal development of neutrophils in Hifa mice. Neutrophils in the bone marrow, spleen and peripheral blood were quantified by immunostaining for D11b in combination with Gr.1. N: normoxia (1% O ); H: hypoxia (.5% O ); Macs: macrophages.

Imtiyaz et al., Fig. S3 loxp/1loxp, LysM-re loxp 1loxP (Δ) 1. 1..... LPS : - + - + 1 1 1 1 LPS : - + - + Macs Ds Ds Ds Ds LPS : - + - + - - + - + - + + Supplemental Figure S3. HIF-α is still expressed in Hifa dendritic cells. () Insufficient deletion of the Hif-α floxed (i.e. loxp) allele. DN was isolated from differentiated bone marrow-derived dendritic cells and subjected to PR analysis. D1 and D indicate primary dendritic cells generated from two independent mice with Hifa genotype, Tail DN obtained from Hifa mice was used as a control. () Dendritic cells were treated with LPS (1 ) for hrs under normoxia and hypoxia, and mrns of HIF-α and HIF-1α was quantified by QRT-PR. () HIF-α protein level in dendritic cells was evaluated by Western blotting following LPS treatment. Macs: macrophages; Ds: dendritic cells.

Imtiyaz et al., Fig. S 5 3 1.5 5.5 5, n.t., n.t., IL-, IL-, n.t., n.t., IL-, IL- 1 15 1 9 3 Supplemental Figure S. M responses of Hifa macrophages. () MDMs were treated with recombinant IL- for 3 hrs a concentrations indicated. rginase activity was measured using an isonitrosopropiophenone (ISPF)-based method. () Mannose receptor expression was determined by flow cytometry following hrs of IL- stimulation. () FN1 expression was evaluated by QRT-PR following hrs of IL- stimulation. IL- concentration used for () and () is 5. N: normoxia; H: hypoxia.

Imtiyaz et al., Fig. S5 1 1% O +/+ LPS: INF-γ: 1 1 1 1 1 1 LPS: INF-γ:.5% O 1 1 1 1 +/+ Supplemental Figure S5. IL- production of M1-stimulated Hifa +/+ and Hifa MDMs under normoxia () and hypoxia () was determined by ELIS.

Supplemental Table S1: haracterization of H tumors in HIF-α LysM-re mice n value p value (, ) (t-test) Tumor number* 3. ±.7 1.1 ±. (7, ). Tumor area (% tumor/liver area) 1. ± 5.5. ± 5.3 (1, 1).91 lood vessel number** Luminized 1.7E-5 ± 3.E- 1.9E-5 ± 3.1E- (15, 15).59 Non-luminized.9E- ± 7.1E-7 5.E- ±.E-7 (15, 15).9 * Total tumor number per liver section ** lood vessel number per unit tumor area