Supplementary Figure 1. Lymphadenopathy, mitogen response, effector cells, and serum Ig assessment. (a) Computerized Tomography (CT) images demonstrating lymphadenopathy (arrows) in patient F.II.1 and absence of spleen (removed surgically). (b) Three dimensional surface rendered image with cut plane at level of porta hepatis showing lymph node masses surrounding the portal vein and adjacent vasculature (darker red mass within white oval). (c) 3 H- Thymidine incorporation in counts per minute (CPM) to assess proliferation of PBMCs after three days in response to the indicated stimulus. Each symbol represents an individual healthy control subject (Ctrl, n = 10) or patient (Pt, n = 10). Small horizontal lines indicate mean (± s.d.). * P < 0.0001, ** P = 0.0002, *** P < 0.0001, **** P < 0.0001 (Mann- Whitney test). (d) Cumulative data for multiple healthy controls (Ctrl, n = 8) and patients (Pt, n = 9) showing % CCR7 - negative cells among CD8 + T cells in the peripheral blood. Small horizontal lines indicate mean (± s.d.). * P < 0.0001 (unpaired t- test). (e) IgM (left) and IgA (right) serum concentrations as a function of the patient's age. Dotted lines indicate the upper and lower boundaries of the normal range from healthy subjects. Data are representative of ten independent experiments with one patient each (c), four independent experiments (d) or two to ten separate measurements over time for each of the nine indicated patients. 1
Supplementary Figure 2. Patient B cell defects. (a) The proportion of total B cells (i.e., CD20 + cells) within the lymphocyte population of healthy controls (Ctrl, n = 6) compared to patients (Pt, n = 7). Small horizontal lines indicate mean (± s.d.). (b, c) Expression of (b) CD5 on transitional and naïve B cells and of (c) surface IgG and IgA on memory B cells from healthy controls (red histogram) and patients (blue histogram) was determined by flow cytometry. (d) CFSE- labeled naïve B cells were cultured with CD40L, CD40L+CpG, CD40L+anti- Ig or CD40L together with IL- 4, IL- 10, or IL- 21 for 5 days before being assessed for dilution of the dye in healthy control (Ctrl, red) and patient (Pt, blue) samples. (e) Expression of AICDA mrna was determined by quantitative PCR after stimulation of naïve B cells with the indicated stimulus. (f,g) Secretion of IgM, IgG, and IgA by stimulated naïve (f) and memory (g) B cells was determined by ELISA. Values for healthy controls (Ctrl) and patients (Pt) are given as mean ± sem of replicate cultures. * P = 0.03, ** P = 0.005 (unpaired t- test). Data are representative of four independent experiments (b,c), two independent experiments (e), three independent experiments (f) or two independent experiments (g) or are from five independent experiments (a) or one experiment (d). 2
Supplementary Figure 3. Alignment of amino acid sequence of human p110α (PIK3CA) with that for human p110δ (PIK3CD). Residues mutated in our patients are shown in yellow, cyan and magenta. 3
Supplementary Figure 4. Hyperphosphorylation of Akt and intact association of mutant p110δ with p85α. (a) Quantification of band intensities for the immunoblot shown in Fig. 2d in which serum- starved, activated T cells were assessed for p110δ, Akt, p- Akt (S473), and β- tubulin in patients D.II.1, D.II.2, and E.1 compared to three healthy controls (Ctrl) with 10 min anti- CD3 stimulation (+) or not ( ). Total Akt values were normalized to β- tubulin abundance, then the ratio of p- Akt (S473) to normalized Akt was graphed. Small horizontal lines indicate mean (± s.d.). * P = 0.0002, ** P = 0.01, *** P = 0.008 (unpaired t- test). (b) Summary of p- Akt (S473) by flow cytometry comparing mean fluorescence intensity (MFI). Basal p- Akt (S473) in paired (i.e., cultured for 4
the same duration) T cell blasts from healthy controls (Ctrl, n = 5) and patients (Pt, n = 5) (left) or induced p- Akt (S473) after 10 min stimulation with anti- CD3 in T cell blasts from Ctrl (n = 3) and Pt (n = 3) (right, with mean (± s.d.)) are shown. * P = 0.02 (paired t- test), ** P = 0.03 (unpaired t- test). (c) Immunoblots for the indicated proteins using PBMC lysates from patients with mutant p110δ or healthy controls (Ctrl) after stimulation with beads coated with anti- CD3 and anti- CD28 for 10 min (+) or not ( ). (d,e) Representative histograms (left) and cumulative MFI data (right) for flow cytometry staining for p- Akt (T308) in patient (Pt, n = 3) versus healthy control (Ctrl, n = 3) T cell blasts, gating on CD4 + or CD8 + cells. Small horizontal lines indicate mean (± s.d.). * P = 0.03 (unpaired t- test). (f) Quantification of band intensities for the immunoblot shown in Fig. 2e together with data from two additional independent experiments. Numbers indicate the relative ratio (WT set to 1.0) of p- Akt (S473) to total Akt normalized for Flag expression. Small horizontal lines indicate mean (± s.d.). * P = 0.05, ** P = 0.009 (unpaired t- test). (g) Immunoblot for p- Akt (S473) and β- tubulin on lysates from the human H9 T cell line overexpressing WT or the indicated mutant p110δ. (h) Immunoprecipitates (IP) of empty vector (EV), wild- type (WT), or mutant p110δ fused to a Flag epitope in HEK293T cells overexpressing p85α were blotted with antibodies against p85α, the Flag epitope, β- actin or immunoglobulin heavy chain (IgH). Data are from one experiment with three patients (a) or three independent experiments (f) or are representative of three independent experiments (b,d,e), four independent experiments with one patient each (c) or two independent experiments (g,h). 5
Supplementary Figure 5. Patient CD8 + T cells are hyperactivated with characteristics of enhanced effector function. (a) Cumulative data for MHC class I- peptide tetramer (Tet) stains for EBV lytic (Ctrl n = 4 and Pt n = 4) and EBV latent antigens (Ctrl n = 3 and Pt n = 3). (b) Flow cytometry of gated EBV lytic and latent antigen- specific CD8 + T cells, stained for CCR7 and CD45RA. The percent of total events is shown in quadrants. (c) CD38 expression on the populations identified in (a) for patient G.1 (blue) compared to those for a healthy control (Ctrl, red). (d) Cumulative data for intracellular IFN- γ production in CD8 + T cell blasts from healthy controls (Ctrl, n = 3) versus patients (Pt, n = 4). Small horizontal lines indicate mean (± s.d.). P = 0.09 (unpaired t- test). (e) Cumulative data for granzyme B expression in CD4 + or CD8 + T cell blasts stimulated with low- dose, 6
immobilized anti- CD3. Small horizontal lines indicate mean (± s.d.). * P = 0.003, ** P = 0.01 (unpaired t- test). (f) Total LAMP- 1 levels in activated CD8 + T cells from patients A.1 and G.1 compared to healthy control (Ctrl). (g) Cytolysis of P815 targets by anti- CD3- mediated redirected lysis for the indicated patients (Pt, n = 4) and healthy controls (Ctrl, n = 4). (h) Composite data for % CD57 + CD8 + T cells in patient (Pt, n = 4) versus healthy control (Ctrl, n = 4) PBMCs. Small horizontal lines indicate mean (± s.d.). * P = 0.002 (unpaired t- test). Data are from three (latent) or four (lytic) independent experiments (a) or three independent experiments (h) or are representative of four independent experiments (b,c,g) or two independent experiments (d,e,f). 7
Supplementary Figure 6. Expression of PD- 1 on CD3 + cells in peripheral blood. PBMCs were gated on CD3 + cells and assessed for CD45RA versus PD- 1 expression in indicated patients (Pt, n = 7) and healthy controls (Ctrl, n = 2 adult and n = 2 pediatric). Data are representative of four independent experiments. 8
Supplementary Figure 7. Normal expression of signaling molecules in patient T cell blasts. (a) Immunoblots for PTEN, PKCθ, p110δ, p- Erk, total Erk, and β- tubulin in T cell lysates from patients E.1 and F.II.1 or healthy control (Ctrl) cells stimulated with anti- CD3 for the times indicated in minutes (min). (b) Immunoblot for the PH domain- containing ARF6, p27 kip1, and β- tubulin in indicated patient (n = 5 samples) and healthy control (Ctrl, n = 5 samples) T cell blasts after 10- min stimulation with anti- CD3 (+) or not ( ). Data are from one experiment with two (a) or five (b) different patient samples. 9
Supplementary Figure 8. Increased, glucose- and amino acid- dependent basal S6 phosphorylation and glucose uptake in patient T cell blasts. (a) Cumulative flow cytometric analysis of mean fluorescence intensity (MFI) for stimulated and unstimulated, permeabilized patient (Pt) or healthy control (Ctrl) T cell blasts after staining for p- S6 (S235, S236). Paired healthy control and patient blasts (i.e., cultured for the same duration) are connected by a line. * P = 0.04 (paired t- test). (b) Data from the same experiment as that shown in Fig. 4c but where cells were first rested in PBS for 2 hr before flow cytometric analysis of p- S6 (S235, S236) in unstimulated T cell blasts from patients G.1, D.II.1, and D.II.2 compared to healthy controls (Ctrl). (c) Glucose uptake by flow cytometric analysis of 2- NBDG fluorescence (linear MFI) after a 20- minute incubation period in glucose- starved T cell blasts from healthy controls (Ctrl, n = 3) and patients (Pt, n = 3). Paired healthy control and patient blasts (i.e., cultured for the same duration) are connected by a line. * P = 0.03 (paired t- test). Data are from three independent experiments (a) or one experiment with three different patients (b) or are representative of five independent experiments (c). 10
Supplementary Figure 9. CT images comparing hepatosplenomegaly and lymphadenopathy in patient A.1 before and after treatment with rapamycin. Coronal reformations at the level of the tracheal bifurcation reveal more severe hepatosplenomegaly, hilar and mediastinal adenopathy, and splaying of tracheal bifurcation before (a) compared to after (b) rapamycin treatment. 11
Race Haitian/Hispanic Caucasian Kinase Domain Helical Domain C2 Domain A.1 B.III.1 C.1 D.I.1 D.II.1 D.II.2 E.1 F.II.1 G.1 African American (deceased) Caucasian Caucasian Caucasian Asian Caucasian African American CMV PCR serology CMV lymphadenitis **POS N/A - ON IVIG YES NEG NAIVE NO N.D. NEG POS NO YES POS YES NEG POS NO NEG POS YES NEG Naïve NO NEG N/A- ON IVIG NO Highest EBV load (copies/μl) Bacterial infections Lympho- proliferation Sites of mucosal lymphoid aggregates Other pathology 3,850 15,000 5,000 1,900 1,100 <250 63,350 2,250 20,050 infections, bronchiectasis infections infections, H. influenza meningitis infections infections infections infections, bronchiectasis infections infections, bronchiectasis Diffuse LAP, HSM Cervical LAP Diffuse LAP, HSM N.D. Diffuse LAP, HSM NO Diffuse LAP Diffuse LAP, HSM Diffuse LAP, HSM Airways and GI mucosa Autoimmune cytopenia, nodular regenerative hyperplasia of the liver Airways (obstructive) N.D. Airways and GI mucosa Airways and GI mucosa (partial obstruction) N.D. N.D. N.D. NO Pharyngeal mucosa Eosinophilic esophagitis Airways (obstructive) NO N.D. Autoimmune cyopenia, splenectomy Airways and GI mucosa Autoimmune cyopenia, splenectomy, pseudotumor cerebri Supplementary Table 1. Additional table of clinical findings. POS = positive; NEG = negative; N/A = not applicable; IVIG = intravenous immunoglobulin; N.D. = not determined; LAP = lymphadenopathy; HSM = hepatosplenomegaly; GI = gastrointestinal; **Chronic intermittent viremia. 12
Name Sequence 5ʹ - - 3ʹ Ta GC% Size PIK3CD_2F CTTCCAAAGGTCTCACCCAG 59.69 55 275 PIK3CD_2R TCTCTGAGCACCAAGGTCTG 59.12 55 PIK3CD_3_4F* CAGCTCTCCACCCTCCCT 60.35 66.67 749 PIK3CD_3_4R* CACAGACACCTGGCAAACAC 60.2 55 PIK3CD_5F CAGGTGTCTGTGCATGTGTG 59.76 55 482 PIK3CD_5R CACCCAGGCCCTATCCAG 61.45 66.67 PIK3CD_6F AATCCTGGTGTCCAGGGAG 59.9 57.89 287 PIK3CD_6R GTAGCACATGGAGTTGGACG 59.17 55 PIK3CD_7F CTGCACTTTGAGCCGTGTTA 60.05 50 201 PIK3CD_7R CCAGGATACAGCCACCTTGT 59.99 55 PIK3CD_8F TTCAAGGGGGAGACTGACAC 60.09 55 358 PIK3CD_8R GTACTGGCTCTCCGGGGT 60.07 66.67 PIK3CD_9_10F GTCTGGAGGCCCCTGAGT 60.2 66.67 460 PIK3CD_9_10R CAGGGAGCACCCTCTGAAG 60.95 63.16 PIK3CD_11_12F CATATCTGGGGCCTTCCC 60.24 61.11 615 PIK3CD_11-12R GTGGGTAGCCAGAGGCTGT 60.28 63.16 PIK3CD_13F ACCCTTACCCTGACCACCTC 60.23 60 231 PIK3CD_13R AGCTGCCCTCTGGAGAAGT 59.14 57.89 PIK3CD_14F AGCTCCCTCCTGTCCTGAGT 60.4 60 252 PIK3CD_14R AGACTCAGGGGCTGGGATT 61.01 57.89 PIK3CD_15F CCTCGCTAGGTCCTGCTG 59.68 66.67 233 PIK3CD_15R GGATTCCCAGACGCTCAG 59.29 61.11 PIK3CD_16_17F CCTGAGCGTCTGGGAATC 59.29 61.11 521 PIK3CD_16_17R CTAGGAGCACCCCAGGACC 61.99 68.42 PIK3CD_18F CCAGAAACTCACGCTTCTCC 59.99 55 209 PIK3CD_18R ATGCCACCTTCAACAAGGAC 59.97 50 PIK3CD_19F GAGTTTCTGGGGCTCAAGTG 59.84 55 287 PIK3CD_19R CTTGGAAAGGAGAGGGAACC 60.04 55 PIK3CD_20F GGAGCTGCAAAATGGTATGG 60.47 50 256 PIK3CD_20R CAGAGCTGTGTGCTAGGCAG 59.95 60 PIK3CD_21F GTCTCCCCTGGATTCTCTCC 60.01 60 277 PIK3CD_21R AACCTCTGCCCTGTTCCCT 61.04 57.89 PIK3CD_22F GGAGTTCCCAGAGCCTCACT 60.79 60 249 PIK3CD_22R CCCTCCTAGGTCACATTGCT 59.16 55 PIK3CD_23F CTCTGAAGTCCCCAGAGAGG 61.88 61.11 885 PIK3CD_23R TCCTGAGGACCAGCGTAGAT 60.18 60 PCR cycling conditions: 94 C for 2 min, [94 C for 30 s, 60 C for 30 s, 72 C for 1 min] (30 cycles), 4 C hold Sequencing cycling conditions were as follows: 96 C for 30 s, [96 C for 30 s, 60 C for 4 min] (30 cycles), 4 C hold *Betaine (5 M) (Sigma- Aldrich) was added 1 M (final) in the PCR and sequencing reactions for exons 3 and 4 Supplementary Table 2. PCR and sequencing primers with cycling conditions. 13
Somatic p110α Mutations in Cancer N345K E542K and E545K H1047R Mechanism Disrupts inhibition of p110 by p85 by hindering the interaction of p110 C2 domain with p85 i- SH2 domain Disrupts inhibition of p110 by p85 by blocking the interaction between p110 helical domain and p85 N- SH2 domain Promotes association with the plasma membrane, mimics Ras binding, and causes activating conformational changes in the activation loop Supplementary Table 3. Residues of human p110α commonly mutated in cancers map to the patient mutation sites in p110δ and suggest pathogenic mechanisms. 14