Development of important genes during breast carcinogenesis

Similar documents
Supplementary Information Titles Journal: Nature Medicine

Supplementary Figures

Supplementary Figures

Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

TITLE: Enhancement of Tumor Immunotherapy by Blockade of a Prostate Tumor Derived Immunosuppressive Factor

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

AP VP DLP H&E. p-akt DLP

supplementary information

Functional genomics reveal that the serine synthesis pathway is essential in breast cancer

Early Embryonic Development

FGL2 A new biomarker for cancer in a simple blood test

Molecular and genetic analysis of stromal fibroblasts in prostate cancer

microrna Presented for: Presented by: Date:

Supplementary methods:

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Toxicity profiles of heterocyclic aromatic amines Bettina Seeger and Pablo Steinberg

stability and tumor suppression

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Key words: epidermal growth factor receptor, c-erbb-2, esophageal cancer, gastric cancer, colonic cancer

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Smoke Like a Man, Survive Like a Woman

TITLE: Induction of Ephs/Ephrins-Mediated Tumor Cells-Endothelial Cells Repulsion as an Anti-Cancer Therapeutic Approach

Supplemental Figure 1

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

BIO360 Fall 2013 Quiz 1

Section D: The Molecular Biology of Cancer

THE STUDY ON RELATIONSHIP BETWEEN CIGARETTE SMOKING AND THE p53 PROTEIN AND P21 PROTEIN EXPRESSION IN NON-SMALL LUNG CANCER

Supporting Information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Nuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.

Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma

ER- 36, a Novel Variant of ER-, is Expressed in ER-positive and -negative Human Breast Carcinomas

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TITLE: The Role of Constitutively Active Prolactin Receptors in the Natural History of Breast Cancer

8/1/2016. FDG uptake in a heterogeneous microenvironment: A single-cell study. Heterogeneity of FDG uptake in tumors grafts. Goals of the study

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER"

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Information

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2

Down-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer

CELL CYCLE REGULATION AND CANCER. Cellular Reproduction II

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

CH Cho *, J Yu, WKK Wu 1,2

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Biochemistry of Cancer and Tumor Markers

CONTRACTING ORGANIZATION: University of Illinois Chicago, IL

Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression

5. Summary of Data Reported and Evaluation

BIT 120. Copy of Cancer/HIV Lecture

Abnormality of p16/p38mapk/p53/wipl pathway in papillary thyroid cancer

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop

THYROID TUMOR DIAGNOSIS: MARKER OF THE MONTH CLUB

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

Supplementary Information

SUPPLEMENTARY INFORMATION

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Chapter 4 Cellular Oncogenes ~ 4.6 -

Rare Breast Tumours. 1. Breast Tumours. 1.1 General Results. 1.2 Incidence

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

Basement membrane in lobule.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D

Supplemental Information

Page 2. When sirna binds to mrna, name the complementary base pairs holding the sirna and mrna together. One of the bases is named for you. ...with...

CCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask.

Antioxidants and Viral Infections: Host Immune Response and Viral Pathogenicity

American Society of Cytopathology Core Curriculum in Molecular Biology

Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Material

MicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee

Abstract : Julian Spallholz; Texas Tech University, Lubbock, Texas

SUPPRESSION OF CLAUDIN-7 ENHACES HUMAN LUNG CANCER CELL SURVIVAL. Spencer M. Jackson. Honors College. East Carolina University

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Section D. Genes whose Mutation can lead to Initiation

SUPPLEMENTARY FIGURES

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:

Transcription:

Nagoya Med. J., 107 Development of important genes during breast carcinogenesis AYA NAIKI-ITO Department of experimental pathology and tumor biology Nagoya City University Graduate School of Medical Sciences Carcinogen exposure induces many gene expression changes in either target or non-target organ, some of them may be important for carcinogenic process but others not. In this study, we attempt to find crucial genes which may be important for mammary carcinogenesis. For this purpose, we used human c-ha-ras proto-oncogene transgenic rats Hraswhich are highly sensitive for mammary carcinogens, N-methyl-N-nitrosourea MNU,, -dimethyl benz a anthracene DMBA and -amino- methyl phenylimidazo-b pyridine PhIP. We found Gpx as an up-regulated gene commonly in all mammary carcinomas induced the different three carcinogens by DNA microarray analysis, and its up-regulation was confirmed by quantitative RT-PCR. In addition, immunohistochemically highly expression of GPX was detected in not only rat mammary carcinomas but also human breast cancers. Knockdown of GPX expression by sirna resulted in significant growth inhibition in both rat and human mammary carcinoma cell lines by p dependent manner. Thus, those data clearly demonstrated that GPX is involved in mammary carcinogenesis and cell proliferation in both rat and human, indicating that GPX may be a novel target of prevention and therapy for breast cancers. HER c-ha-ras 107

108 Hras Hras N-methyl-N-nitrosourea MNU dimethylbenz a - anthracene DMBA amino- -methyl- -phenylimidazo-b]pyridine PhIP Hras RNA DNA CodeLink rat whole genome Hras Glutathione peroxidase Gpx Hras MNU DMBA PhIP RNA Gpx mrna RT- PCR Figure Hras - DMBA RMC- Gpx mrna Table Western blotting Gpx Gpx Figure MCF- T D MDA-MB- GPX mrna Table Figure. Relative Gpx expression levels in carcinogeninduced mammary cancers. The data were obtained by quantitative RT-PCR as described in the materials and methods. Gpx mrna expression level was adjusted by cytokeratin.*, p,**, p compared with control value Student s t test. Table. GPX mrna level of rat and human mammary carcinoma cell lines.

109 Figure. A. Western blot of normal mammary tissue and carcinoma in Hras rats. Lane to, normal mammary tissue. Lane to, carcinogen-induced mammary cancer; to, MNU, to, DMBA,and to, PhIP-induced. C. Immunohistochemical findings of Gpx in rat mammary carcinomas induced by MNU, DMBA and PhIP. Gpx was strongly positive in the cytoplasm of tumor cells. Non-tumorous mammary glands of Hras rats were completely negative. GPX GPX GPX Figure GPX GPX sirna Figure. Histological appearance of human breast cancers and GPX immunohistochemical staining. A, C, E : H&E,and B, D, F : immunohistochemistry. GPX staining was positive in the cytoplasm of human breast cancer cells regardless of tumor type. A to F were invasive ductal carcinoma; A and B were papillotubular carcinoma, C and D were solid-tubular carcinoma and E and F were scirrhous carcinoma. GPX GPX p p p p GPX p GPX Figure DNA

110 GPX GPX GPX p in vitro GPX GPX p Figure. GPX affects p -dependent cell proliferation in both rat and human mammary cancer cells. A. Rat mammary cancer cell lines, C with wild-type p showed clear inhibition of cell proliferation by Gpx silencing but not in the C with mutant p. *: Student s t test, p, **: p. Lower graphs show knockdown efficiency by quantitative RT-PCR. B. Human mammary carcinoma cell line, MCF- with wild-type p, showed significant inhibition of cell proliferation by GPX suppression, while another human breast cancer cell line, T D with mutant p showed no apparent change **: Student s t test, p. Lower graphs show knockdown efficiency by quantitative RT-PCR. Gpx GPX mrna GPX MCF- T D MDA-MB- GPX mrna Dumitrescu RG, Cotarla I: Understanding breast cancer risk wheredowestandin? JCell Mol Med : -, Asamoto M, Ochiya T, Toriyama-Baba H, et al.: Transgenic rats carrying human c-ha-ras protooncogenes are highly susceptible to N-methyl-Nnitrosourea mammary carcinogenesis Carcinogenesis : -, Naito A, Suzuki A, Ueda S, et al.: Preferential mammary carcinogenic effects of -amino- methyl- -phenylimidazo, -b pyridine PhIP in human c-ha-ras proto-oncogene transgenic rats Cancer Sci : -, Tsuda H, Asamoto M, Ochiya T, et al.: Highsusceptibility of transgenic rats carrying the human c- Ha-ras proto-oncogene to chemically-induced mammary carcinogenesis Mutat Res : -, YanW,ChenX:GPX, a direct target of p, inhibits oxidative stress-induced apoptosis in a p dependent manner J Biol Chem : -,

111 Chu FF, Esworthy RS, Doroshow JH: Role of Sedependent glutathione peroxidases in gastrointestinal inflammation and cancer Free Radic Biol Med :-, Chu FF, Doroshow JH, Esworthy RS: Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI J Biol Chem : -, Banning A, Kipp A, Schmitmeier S, et al.: Glutathione Peroxidase Inhibits Cyclooxygenase- - Mediated Migration and Invasion of HT- Adenocarcinoma Cells but Supports Their Growth as Tumors in Nude Mice Cancer Res : -, Dewa Y, Nishimura J, Muguruma M, et al.: Gene expression analyses of the liver in rats treated with oxfendazole Arch Toxicol : -, Lacroix M, Toillon RA, Leclercq G: p and breast cancer, an update Endocr Relat Cancer : -,

112