Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Similar documents
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Table 1. List of primers used in this study

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

SUPPLEMENTARY INFORMATION

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Nature Genetics: doi: /ng.3731

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

SUPPLEMENTARY FIGURES

Supplementary information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Information. Supplementary Figure 1

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Supplemental Figure 1

Supplementary Information Titles Journal: Nature Medicine

SUPPLEMENTARY INFORMATION

Supplementary Information

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

SUPPLEMENTARY INFORMATION

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

SUPPLEMENTARY INFORMATION

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplemental Table S1

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

T H E J O U R N A L O F C E L L B I O L O G Y

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

WDR62 is associated with the spindle pole and mutated in human microcephaly

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Conditional and reversible disruption of essential herpesvirus protein functions

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

Nature Medicine: doi: /nm.4322

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supporting Information Table of content

SUPPLEMENTARY INFORMATION

Supplementary Figures

SUPPLEMENTARY INFORMATION

Zhu et al, page 1. Supplementary Figures

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Target Protein Antibody name Product number Manufacturer Species Epitope Dilution Aggrecan Anti-aggrecan AB1031 EMD Millipore Corp Rabbit

Supplementary methods:

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish

Name Animal source Vendor Cat # Dilutions

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary information Novel VCP modulators mi2gate major pathologies of rd10, a mouse model of re2ni2s pigmentosa

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplementary Figure 1

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

SUPPLEMENTARY LEGENDS...

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

SUPPLEMENTARY INFORMATION

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supporting Information

Circular RNAs (circrnas) act a stable mirna sponges

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

The subcortical maternal complex controls symmetric division of mouse zygotes by

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Transcription:

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments. ARPE-19 cells were transfected with a vector containing the human AdipoR1 empty vector, AdipoR1 shrna, and a non-specific shrna (negative control). Mouse skeletal muscle lysate was used as a positive control. The first lane displays the marker showing bands at 52 KDa and 31 KDa. (b, c) Densitometric measurement of western blots from three independent experiments showing an increase of 81% in AdipoR1 protein content in ORF expressing cells (b) and decrease of 38.1% in AdipoR1 silenced cells (c). Responses are expressed relative to controls. AdipoR1 was standardized using GAPDH. shrna, short hairpin RNA; ORF, open reading frame.

Supplementary Figure 2. ELOVL4 is not down-regulated in AdipoR1 -/- retinas. (a) Western blot demonstrating no significant difference in ELOVL4 concentration between AdipoR1 +/+ and -/- retinas. (b) Immunohistolocalization of ELOVL4 in an AdipoR1 +/+ retina. Anti-ELOVL4 label (green) appears within the ONL and inner segments of photoreceptors. (c) Immunohistolocalization of ELOVL4 in an AdipoR1 -/- retina. Anti-ELOVL4 label (green) also appears within the ONL and inner segments of photoreceptors. ONL, outer nuclear layer. Nuclei appear blue (DAPI labeling). 23- day-old mice were used for both western blot analysis and immunolocalization. ONL, outer nuclear layer. Magnification bar, 50 µm.

Supplementary Figure 3. Full fragmentation spectra and molecular structures of -/- VLC-PUFAs. (a) Spectrum of PC 54:8 (m/z = 1084.7 = M(1025.8) + Hac (60) H) shows the fatty acid composition as FA20:4 and FA34:4. m/z of 724 is produced from (M-(FA20:4-H)+2H, m/z 499 from FA34:4 and m/z 303 from FA20:4. (b) Spectrum of PC 54:7 (m/z = 1086.7 = M(1027.8) + Hac (60) H) shows the fatty acid composition as FA20:4 and FA34:3. m/z of 726 is produced from (M-(FA20:4-H)+2H, m/z 501 from FA34:3, m/z 528 from (M-(FA34:3-H)+2H, and m/z 303 from FA20:4. (c) Spectrum of PC 56:9 (m/z = 1110.7 = M(1051.7) + Hac (60) H) shows the fatty acid composition as FA20:4 and FA36:5. m/z of 750 is produced from (M-(FA20:4-H)+2H, m/z 525 from FA36:5, and m/z 303 from FA20:4. (d) Spectrum of PC 56:8 (m/z = 1112.7 = M(1053.7) + Hac (60) H) shows the fatty acid composition as FA20:4 and FA36:4. m/z of 752 is produced from (M-(FA20:4-H)+2H, m/z 527 from FA36:4, and m/z 303 from FA20:4. m/z of 331 can be from FA22:4, and m/z 499 from 36:5. (a) PC54:8 is composed of FA20:4 (arachidonic acid) and FA34:4. (b) PC 54:7 is composed of FA20:4 (arachidonic acid) and FA34:3. (c) PC 56:9 is composed of FA20:4 (arachidonic acid) and FA36:5. (d) PC 56:8 is composed of FA20:4 (arachidonic acid) and FA36:4, or FA22:4 and FA34:4. The molecular structures of these four phospholipids accompany each spectrum.

Supplementary Figure 4. Sphingomyelin levels in AdipoR1 +/+ and -/- retinas does not change. (a) Chromatogram of retention times for phosphatidylcholine and sphingomyelin, illustrating excellent separation of species. (b, c) Mass spectra of AdipoR1 +/+ and -/- retinas, demonstrating that sphingomyelin levels are not affected by the lack of AdipoR1.

Supplementary Figure 5. Generation of the AdipoR1 -/- mice. (a) Design of the gene trap mutation to produce the AdipoR1 -/- mice, and the RT-PCR analysis of the AdipoR1 +/+ and -/- mice to demonstrate the loss of the transcript in the AdipoR1 -/- animals. (i) Gene trap mutation of the AdipoR1 gene. SA, splice acceptor sequence; βgeo, beta galactosidase-neomycin resistance fusion gene. The dotted line in the wild-type (AdipoR1 +/+ ) locus indicates normal splicing from exon 5 into exon 6, leading to normal transcript expression. The dotted line in the mutated locus indicates splicing from exon 5 into the gene trap vector rather than exon 6, leading to disruption of the normal transcript. (ii) AdipoR1 RT-PCR. Primers C and D are complementary to AdipoR1 exons 5 and 6 flanking the insertion site of the gene trapping vector. (iii) RT-PCR, using primers C and D, shows absence of endogenous message in kidney and spleen of AdipoR1 -/- animals. RT, reverse transcription.targeted disruption of the AdipoR1 gene locus. (b) Targeting strategy used to disrupt the AdipoR1 locus. Homologous recombination (represented by X) between the targeting vector and the AdipoR1 gene results in the replacement of exons 2-4 with the selection cassette. (c) Southern hybridization indicating proper gene targeting in the embryonic stem cell clones.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback