a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Similar documents
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Figure 1

Plasma exposure levels from individual mice 4 hours post IP administration at the

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Figure S1A. Blood glucose levels in mice after glucose injection

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

SUPPLEMENTARY LEGENDS...

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Materials for

Supplementary Materials for

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Table 1. List of primers used in this study

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Expanded View Figures

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

SUPPLEMENTAL DATA. Lumen area ( m 2 )

mtorc2 controls actin polymerization required for consolidation of long-term memory

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1

Supplementary Figure 1

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

SUPPLEMENTARY MATERIAL

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

2.5. AMPK activity

Supplementary Figures

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Figures:

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

SUPPLEMENTARY INFORMATION

mm Distance (mm)

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Boucher et al NCOMMS B

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Supplementary Figure S1 Supplementary Figure S2

Supplemental Figure S1. RANK expression on human lung cancer cells.

SUPPLEMENTARY INFORMATION

Supplementary Information

Supplementary methods:

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

Supplementary Materials for

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

doi: /nature14508 Rappsilber et al.

SUPPLEMENTARY FIGURES AND TABLE

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

Tbk1-TKO! DN cells (%)! 15! 10!

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

SUPPLEMENTARY INFORMATION

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Figure 1

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

SUPPLEMENTARY INFORMATION

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Xiangde Liu, Amy Nelson, Xingqi Wang, MahaFarid, Yoko Gunji, Jun Ikari, ShunIwasawa, HeshamBasma, Carol Feghali-Bostwick, Stephen I.

SUPPLEMENTARY INFORMATION

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

SUPPLEMENTARY INFORMATION

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Transcription:

a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos! β-actin! enos/β-actin (a.u.) 1.5 1..5. WT Nogo-A/B-deficient e! WT! Nogo-A/B-deficient! nnos! β-actin! Aorta! nnos/β-actin (a.u.) 1.5 1..5. Supplementary Fig. 1! Nature Medicine: doi.138/nm.3934

b! 15 1 5 3 1 4 e r 4 5 3 2 1 4 ** 8 18 15 ** 2 2 22 pmol*mg-1*ml-1 25 pmol*mg-1*ml-1 Nogo-A/B-deficient pmol*mg-1*ml-1 Total camide (pmol*mg-1*ml -1) WT 2 dh d! c! ontrol! myriocin.3 nm! myriocin 1 nm! 1 5 8 4 2 dh -S 1P dh Sp h Sp h S1 P e! Sphinganine inhibition (%) a! 3 9.1.1 1 1 1 1 Dose (nmol/l) myriocin 3 nm!.3 1 3 1 3 1 3! HUVE + myriocin (nm)!! SM! PS.1 e nin ga hin de! Sp ami r e myriocin 1 nm! f! microsomes! WT! soluble! fraction! Ng-A/BNg-A/Bdeficient! WT! deficient!! myriocin 3 nm! L! alnexin! HSP9! Supplementary Fig. 2! Nature Medicine: doi.138/nm.3934

Nature Medicine: doi.138/nm.3934

a! Nogo-A/Bf/f! b! VE-cadhin! αsma! HSP9! c! VE-cadhin! IB4! αsma! HSP9!.8.4. Supplementary Fig. 4! Nature Medicine: doi.138/nm.3934 2. 1..8.4. g! f! E VSM 2. 1..8.4. E VSM Nogo-A/Bf/f SM-Nogo-A/B-deficient 1..8.4. h! 1 % Initial diamet e! Nogo Nogo-A/Bf/f E-Nogo-A/B-deficient 1. Nogo d! VE-cadhin α-sma! αsma E-! Nogo-A/B-deficient! α-sma! SM-! Nogo-A/B-deficient! 5 μm! Nogo-A/Bf/f E-NogoA/B-deficient SM-NogoA/B-deficient 2-9 -8-7 - -5-4 Phe (LogM)

SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. The loss of Nogo-B does not affect the vasoconstriction in response to pharmacological agents. oncentration-response curves of WT and Nogo-A/B-deficient MA in response to (a) PE, (n = 8 WT vs. n = 7 Nogo-A/B-deficient), (b) U-419, (n = 5 p group) and (c) S1P (n = 1 WT vs. n = Nogo-A/B-deficient). WB analysis and relative quantification of (d) enos on MLE from WT and Nogo-A/Bdeficient mice, n = 4 isolations p group, and (e) nnos on WT and Nogo-A/B-deficient aortas (n = 4 aortas from 4 mice p group). β-actin was used as loading control. Data we expressed as the mean ± s.e.m. **P<.1 compared to WT group. Statistical significance was detmined by two-way ANOVA followed by Bonfroni s post-test (a c) and unpaired t-test (d e). Supplementary Figure 2. Sphingolipids levels in vascular SM and SPT assay in E. WT and SM-Nogo- A/B-deficient (a) total camide levels and (b) individual sphingolipid species measured by L/MS as described in Methods. n = 4 independent VSM isolation/group; five mice we used for each VSM isolation. Mean ± s.e.m. (c) Pharmacological inhibition of SPT activity by increasing concentrations of myriocin in HUVE. The inhibition was assessed using [ 3 H]sine as substrate in endothelial cell lysates as described in Methods. amide-8 (camide), sphinganine, phosphatidylsine (PS) and sphingomyelin-8 (SM). (d) Extracted lipids we separated by TL and [ 3 H]sphinganine was detected by using TL scann (TL analyz RITA, Raytest Straubenhardt) and reading values we quantified using a standard curve of [ 3 H]sine. (e) Inhibition of SPT activity, expressed as pcent of the control, by increasing concentrations of myriocin. (f) WB analysis for Nogo-B, SPTL, alnexin and HSP9 in microsomes isolated from WT and Nogo-A/Bdeficient mouse lung. Unpaired t-test was pformed to evaluate the statistical significance. Supplementary Figure 3. Effects of W14 and myriocin on vascular tone regulation. (a) Ach cumulative concentration-response curve in WT mesentic arties treated with myriocin (.3 mg/kg i.p.) or vehicle in presence of L-NAME, (left, n = 7 p group), indomethacin, (middle, n = 13 vehicle vs. n = 9 myriocin), and their combination, (right, n = 5 vehicle vs. n = myriocin). (b) oncentration-response curve of S1P in MA from WT and Nogo-A/B-deficient mice incubated with L-NAME or vehicle. n = 4 p group. (c) WT mesentic arties treated with W14 (1 nm, 45 min) or vehicle, we incubated with L-NAME and the increase in the basal tone was measured as intnal diamet decrease ov the baseline. (n = 11 ctrl vs. n = 5 W14 1 nm). (d) The active diamet of WT mesentic arties treated with diffent concentrations of W14 or vehicle in response to stepwise increase in intraluminal pressure. (n = 12 ctrl vs. n = 5 W14 1 nm and 1 μm). (e) Vasoconstriction induced by PE following W14 treatment of WT mesentic arties. (n = 8 ctrl vs. n = 9 W14 1 nm). (f) Ach-induced vasodilation in WT mesentic arties following W14 (1 nm) treatment. Given that basal and PE-stimulated tone is diffent aft W14 treatment, the following data are expressed as Nature Medicine: doi.138/nm.3934

absolute intnal diamet (μm) of MA. (n = 21 ctrl vs. n = 7 W14 1 nm). (g) In anoth set of expiments, aft incubation with W14, Ach cumulative concentration-response curve was pformed in presence of: L- NAME (left, (n = 8 ctrl vs. n = 5 W14 1 nm),.indomethacin (middle, n = 7 p group) and their combination (right, n = p group). (h) Schematic summary of myriocin and W14 effects on the vascular tone. Data are expressed as the mean±s.e.m. *P<.5; **P<.1 compared to vehicle. Statistical significance was detmined by two-way ANOVA followed by Bonfroni s post-test (a b, d g) and unpaired t-test (c). Supplementary Figure 4: haractization of the re-mediated excision of Nogo-B in E and VSM of E- Nogo-A/B-deficient and SM-Nogo-A/B-deficient mice. (a) IF staining of MA cross-sections for: (top panels) Nogo-B (red) and α-smooth muscle actin (αsma; green) in NogoA/B f/f MA; (central panels) Nogo-B (red) and E with isolectin-b4 (IB4, green) in SM-Nogo-A/B-deficient MA; and (bottom panels) Nogo-B (red) and αsma (green) in SM-Nogo-A/B-deficient MA. (b) Westn blot analysis for Nogo-B in E isolated from NogoA/B f/f and E-Nogo-A/B-deficient lungs. (c) Westn blot analysis for Nogo-B in VSM isolated from NogoA/B f/f and SM-Nogo-A/B-deficient thoracic aortas as described in Methods. Heat shock protein 9 (HSP9) was used as loading control. Vascular endothelial cadhin (VE-cadhin) and αsma we used as lineage marks of E and smooth muscle cells/fibroblasts, respectively. (d) RT-PR for Nogo-B in E isolated from NogoA/B f/f and E-Nogo-A/B-deficient lungs; RT-PR for (e) αsma and (f) VE-cadhin in endothelial and smooth muscle cells mrna isolated from NogoA/B f/f and SM-Nogo-A/B-deficient thoracic aortas as described in Methods. (g) Nogo-B expression of thoracic aorta VSM mrna isolated from NogoA/B f/f and SM-Nogo-A/B-deficient mice (h) PE-concentration-response curves of Nogo-A/B f/f, E-Nogo- A/B-deficient and SM-Nogo-A/B-deficient MA. Nature Medicine: doi.138/nm.3934