Supplementary Figure 1.

Similar documents
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Name Animal source Vendor Cat # Dilutions

SUPPLEMENTARY DATA. Supplementary experimental procedures

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

A. Generation and characterization of Ras-expressing autophagycompetent

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Supplementary Figure 1

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

Supplemental Figures:

F-actin VWF Vinculin. F-actin. Vinculin VWF

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supporting Information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supplementary Figure 1.

Supplemental Information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

McWilliams et al., http :// /cgi /content /full /jcb /DC1

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary figure legends

Supplementary Figure 1

Supporting Information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1

perk/erk STAT5B

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Materials for

SUPPLEMENTARY INFORMATION

JCB. Supplemental material. Gu et al.,

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

SUPPLEMENTARY INFORMATION

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

SUPPLEMENTARY INFORMATION

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

SUPPLEMENTARY INFORMATION

LPS LPS P6 - + Supplementary Fig. 1.

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

Supplementary Figures

Supplementary Materials

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Leucine Deprivation Reveals a Targetable Liability

Supplementary Figure 1

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Supplementary Figure 1

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Supplementary Information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

SUPPLEMENTARY INFORMATION

islets scored 1 week month months

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

AP VP DLP H&E. p-akt DLP

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Kaul 1. Kaul et al _Inventory of Supplemental Materials. Supplemental Figures and Figure Legends. Figure S1, related to Figure 1

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Supplementary Figure S1 Supplementary Figure S2

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

SUPPLEMENTARY INFORMATION

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Transcription:

Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass between control and βtsc2 -/-, depending on age. B: Representative images of pancreatic islets isolated from 24 week old mice. C: Mean diameter of isolated islets in μm, represented as means per mice ± s.d. (n = 4), ***, P < 0.001. D: Frequency distribution of islet diameter (24 weeks old mice), represented as mean per mice ± s.d. (n = 4).

Supplementary Figure 2. Accumulation of FoxO1 positive nuclei in Tsc2-shRNA MIN6 cells A: MIN6 cells growing in full medium with the presence or the absence of rapamycin 20 nm were subjected to western-blot. B: MIN6 cells were treated as in (A), and submitted to immunofluorescence with anti- FoxO1 antibody. Nuclei were visualized by DAPI staining and UV illumination. Representative confocal microscopy images are shown.

Supplementary Figure 3. Accumulation of ubiquitin-protein aggregates in βtsc2 -/- islets A: Islet protein extracts were blotted with anti-ubiquitin antibody (P4D1), densitometric quantification is shown, represented as means ± s.d. (n = 2), *, P < 0.05. B: Pancreatic sections were subjected to IHC with antiubiquitin FK2 antibody. Further incubation with anti-insulin antibodies was carried on to confirm β cell identity of positive stained regions, indicated with white arrows. C: Normal rabbit IgG was used as negative control for IHC.

Supplementary Figure 4. Impaired autophagic response to glucose deprivation in βtsc2 -/- islets and tunicamycin treated Tsc2-shRNA MIN6 cells. A: MIN6 cells were subjected to tunicamycin 2 µg/ml stimulation during 20 h in the presence or absence of chloroquine (CQ, 10 µm). B: Isolated islets were stabilized overnight in RPMI 10% FBS and subsequently glucose starved during 20 h in the presence or absence of chloroquine 10 µm. Representative confocal microscopy images are shown. Quantification of LC3B positive puncta is shown, representing mean number per mice ± s.d (n = 3). C: Representative confocal microscopy image showing impaired LC3B puncta formation only in β cells of βtsc2 -/- islets D: Comparison of all experiments performed with LC3B puncta quantification, represented as number of punta/100 µm 2 or punta/cell. Statistically significant differences between control and βtsc2 -/- islets are indicated.scale bars represent 10 µm. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Supplementary Figure 5. Increased mitochondrial markers and accumulation of COX4/p62 positive structures in βtsc2 -/- islets A: Immunohistochemical analysis of pancreatic sections from 35 weeks old mice. Images show staining of mitochondrial proteins (COX4, TOM20, VDAC), increased in βtsc2 -/- islets. Further staining with anti-insulin (red) and anti-glucagon (green) was carried to assess identity of cells within the islet. B: Representative confocal microscopy immunofluorescence images of isolated islets (24-weeks old mice). Images show p62/sqstm1 (red) and COX4 (green) staining. Arrows indicate double positive structures. Nuclei were visualized by DAPI staining. C: Representative confocal microscope images from MIN6 cells stably expressing Tsc2 or scrambled shrna. 24 h rapamycin treatment was performed where indicated. D: Representative confocal microscopy immunofluorescence images of isolated islets (24-weeks old mice: Control, C; βtsc2 -/- vehicle treated, KO veh; βtsc2 -/- rapamycin treated, KO rapa). Images show p62/sqstm1 (red) and COX4 (green) Nuclei were visualized by DAPI staining (blue).

Supplementary Figure 6. Increased mitochondrial density and complexity in β cells of βtsc2 -/- mice Electron micrographs of pancreas embedded in epoxy resin from either 10-weeks or 35-weeks old control and βtsc2 -/- mice.

Supplementary Figure 7. Immunogold labeling A: Negative control (PBSG 1% BSA) B: Positive control (anti-insulin antibody) C: p62/sqstm labeling in 35-weeks old control mice. p62/sqstm seldom localizes in mitochondria, but often seen in autophagic vacuoles, or in cytoplasm. D: p62/sqstm labeling in 35-weeks old βtsc2 -/- mice. Boxed region is magnified in (E) p62/sqstm is frequently seen in mitochondria, particularly in membranes.

Supplementary Table 1. Antibodies. Akt Cell Signaling (#9272) P-Akt (Ser 474 ) Cell Signaling (#9271) ATF4 Santa Cruz (sc-200) β-actin (AC-74) Sigma-Aldrich (A5316) β-catenin Becton-Dickinson (610154) Bcl-2 Cell Signaling (#2876) BiP/Hspa5 (C50B12) Cell Signaling (#3177) Cleaved Caspase-3 Cell Signaling (#9661) Cebpb Santa Cruz (sc-150) CHOP/Ddit3 (B-3) Santa Cruz (sc-7351) Cox4 (3E11) Cell Signaling (#4850) Eif2a Cell Signaling (#9722) P-Eif2a (Ser 51 ) (119A11) Cell Signaling (#3597) P-Eif2ak3/PERK (Thr 981 ) Santa Cruz (sc-32577) FoxO1 (C29H4) Cell Signaling (#2880) P-FoxO1 (Thr 24 ) Cell Signaling (#9464) Glucagon Dako (A0565) Hsp60 Enzo Life Sci (SPA-807) Insulin Dako (A0564) LC3B Cell Signaling (#4108) Nitrotyrosine Merck-Millipore (06-284) p62/sqstm1 Progen (GP62) Pdx1 Merck-Millipore (07-696) S6 (5G10) Cell Signaling (#2217) P-S6 (Ser 235/236 ) Cell Signaling (#2211) Tom20 (F-10) Santa Cruz (sc-17764) Tom20 (FL-145) Santa Cruz (sc-11415) Tsc2 Cell Signaling (#3612) Ubiquitin (FK2) Enzo Life Sci (BML-PW0150) Ubiquitin (P4D1) Cell Signaling (#3936) VDAC Cell Signaling (#4866)

Supplementary Table 2. Oligonucleotides. Cloned into plko.1-neo 1.) For Tsc2 interference S: 5 -CCGGcccgatatgtgttctccaaCTCGAGttggagaacacatatcgggTTTTTG-3 AS: 5 -AATTCAAAAAcccgatatgtgttctccaaCTCGAGttggagaacacatatcggg-3 2.) Control (scrambled) S: 5 -CCGGcctaaggttaagtcgccctcgCTCGAGcgagggcgacttaaccttaggTTTTTG-3 AS: 5 -AATTCAAAAAcctaaggttaagtcgccctcgCTCGAGcgagggcgacttaaccttagg- 3 Nucleotides for the targeting region are displayed in lower case qpcr Cebpb Cyclophilin A Ddit3 Hspa5 S: 5 -ACCGGGTTTCGGGACTTGA-3 AS: 5 -GTTGCGTAGTCCCGTGTCCA-3 S: 5 - CAGACGCCACTGTCGCTTT-3 AS: 5 -TGTCTTTGGAACTTTGTCTGCAA-3 S: 5 -CCACCACACCTGAAAGCAGAA-3 AS: 5 -AGGTGAAAGGCAGGGACTCA-3 S: 5 -TGGAGTTCCCCAGATTGAAG-3 AS: 5 -CCTGACCCACCTTTTTCTCA-3 Genotyping Tsc2 loxp (ex. 3-4) S: 5 -GGTGTTGGAACTGAGCAGAT-3 AS: 5 -CAGCCTTGCCTGTATCTATG-3 Ins-Cre S: 5 - CCGCAGAACCTGAAGATGTTCGC -3 AS: 5 - CAGATTACGTATATCCTGGCAGCG -3

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback