Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Similar documents
Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic

Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Validation of the OMRON 705 IT blood pressure measuring device according to the International Protocol of the European Society of Hypertension

Epidemiology of community pre-hypertensive patients and related risk factors in Chengdu city

Tables of Normal Values (As of February 2005)

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

University of Padova, Padua, Italy, and HARVEST Study Group, Italy

290 Biomed Environ Sci, 2016; 29(4):

24 (TUDCA) TUDCA TUDCA. [DOI] /j.issn

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Validation of the SEJOY BP-1307 upper arm blood pressure monitor for home. blood pressure monitoring according to the European Society of Hypertension

Depok-Indonesia STEPS Survey 2003

Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *

Relationship between cardiovascular risk factors and traditional Chinese constitution in subjects with high-normal blood pressure

300 Biomed Environ Sci, 2018; 31(4):

Thyroid Function and Risk of Non-Alcoholic Fatty Liver Disease in Euthyroid Subjects

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Effect of urinary trypsin inhibitor on inflammatory cytokines and organ function in patients with cardiopulmonary bypass

A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... Monday, July 27, 2009

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Shihui Fu 1,2, Ying Lin 2, Leiming Luo 1* and Ping Ye 1*

Sponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964)

Relationship of Body Mass Index, Waist Circumference and Cardiovascular Risk Factors in Chinese Adult 1

902 Biomed Environ Sci, 2014; 27(11):

ALKA VITA DIABETES TEST

BackBeat Cardiac Neuromodulation Therapy (CNT) for Immediate, Substantial and Sustained Lowering of Blood Pressure. Daniel Burkhoff MD PhD

Conventional and Ambulatory Blood Pressure as Predictors of Retinal Arteriolar Narrowing

SITA 100 mg (n = 378)

Plasma auto-antibodies to angiotensin II receptors are correlated with blood pressure and inflammatory factors in hypertension patients

Supplementary Appendix

Patient is healthy with no chronic disease or significant risk factors [16%].

Research Article The Association of Retinopathy and Plasma Glucose and HbA1c: A Validation of Diabetes Diagnostic Criteria in a Chinese Population

Liver Enzymes Concentrations Are Closely Related to Pre diabetes: Findings of the Shanghai Diabetes Study II (SHDS II) *

SUPPLEMENTAL DATA. Lumen area ( m 2 )

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

Effect of Salt Intake on Plasma and Urinary Uric Acid Levels in Chinese Adults: An Interventional Trial

Higher non-hdl-cholesterol to HDLcholesterol ratio linked with increased nonalcoholic steatohepatitis

Todd S. Perlstein, MD FIFTH ANNUAL SYMPOSIUM

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects

Validation Study Result Form

HbA1c is Positively Associated with Serum Carcinoembryonic Antigen (CEA) in Patients with Diabetes: A Cross-Sectional Study

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients).

Research Article The Prevalence of Nonalcoholic Fatty Liver Disease and Relationship with Serum Uric Acid Level in Uyghur Population

Special Lecture 10/28/2012

Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection

Validation Study Result Form

Adiponectin Level Predicts HDL-Cholesterol Level in Type 2 Diabetes

6/10/2016. Hui-Chun Hsu

Yuqing Zhang, M.D., FESC Department of Cardiology, Fu Wai Hospital. CAMS & PUMC, Beijing, China

How Low Do We Go? Update on Hypertension

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

The Egyptian Journal of Hospital Medicine (Apr. 2017) Vol. 67(1), Page

Evolution of blood pressure from adolescents to youth in salt sensitivies: a 18-year follow-up study in Hanzhong children cohort

NEW RCPCH REFERENCE RANGES-

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Supplementary Online Content

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Nomogram of the Relation of Brachial-Ankle Pulse Wave Velocity with Blood Pressure

Relations of body weight status in early adulthood and weight changes until middle age with metabolic syndrome in the Chinese population

Supporting information

Association Between High-density Lipoprotein Cholesterol and Renal Function in Elderly Hypertension

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi;

NORMAL LABORATORY VALUES FOR CHILDREN

Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese

Zhengtao Liu 1,2,3*, Shuping Que 4*, Lin Zhou 1,2,3 Author affiliation:

Yuliang Cui, Hemei Bu, Xianghua Ma, Sha Zhao, Xiaona Li, and Shan Lu

Serum leptin levels in psoriatic patients with non-alcoholic fatty liver disease

THE PHARMA INNOVATION - JOURNAL

connections among resting heart rate, ambulatory blood pressure and left ventricular hypertrophy

Research Article Elevated Systemic Neutrophil Count Is Associated with Diabetic Macroalbuminuria among Elderly Chinese

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation

NORLAND AVENUE PHARMACY PRESCRIPTION COMPOUNDING FOR VETERINARY MEDICINE

Department of Cardiology, China-Japan Friendship Hospital, Beijing (China) 1

Internal and Emergency Medicine Official Journal of the Italian Society of Internal Medicine. ISSN Volume 8 Number 3

Medicine. Association of Sodium Excretion With Metabolic Syndrome, Insulin Resistance, and Body Fat

Age-related reference ranges

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54

Prediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects

imedpub Journals

Outline of the Report on Cardiovascular Disease in China, 2010

MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers

Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Diet-Related Factors, Educational Levels and Blood Pressure in a Chinese Population Sample: Findings from the Japan-China Cooperative Research Project

Annals of RSCB Vol. XIV, Issue 1

Clinical Role of Inflammation in Metabolic Diseases

Characteristics of blood glucose excursions in type 2 diabetes mellitus patients with three different Traditional Chinese Medicine syndromes

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

2003 World Health Organization (WHO) / International Society of Hypertension (ISH) Statement on Management of Hypertension.

The Value of a BP Determination Method Using a Novel Non-Invasive BP Device against the Invasive Catheter Measurement

BioScience Trends. 2017; 11(4): Department of VIP Medical Service, Beijing Hospital, National Center of Gerontology, Beijing, China; 2

The association between white blood cell subtypes and prevalence and incidence of nonalcoholic fatty liver disease

Biomed Environ Sci, 2018; 31(2):

Transcription:

Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli Liu,, Jue Wang,, Ying Peng, Haibao Shang,, Ning Hou,, Xiaomin Hu,, Yi Ding,, Yao Xiao,, Can Wang,, Fanxin Zeng,, Jiaming Mao,, Jun Zhang,, Dongwei Ma,, Xueting Sun,, Chuanyun Li,, Rui-Ping Xiao,, *, Xiuqin Zhang, * State Key Laboratory of Membrane Biology, Institute of Molecular Medicine, Peking University, Beijing 87, China. Peking-Tsinghua Center for Life Sciences, Beijing 87, China. Beijing Key Laboratory of Cardiometabolic Molecular Medicine, Peking University, Beijing 87, China. Department of Surgery, Third Affiliated Hospital of Peking University, Beijing 87, China. *Corresponding author: Xiuqin Zhang, M.D., Ph.D. Institute of Molecular Medicine, Peking University, Beijing 87, China. E-Mail: zhangxq@pku.edu.cn Tel: (86)--67-. Fax: (86)--676-7. Rui-Ping Xiao, M.D., Ph.D. Institute of Molecular Medicine, Peking University, Beijing 87, China. E-Mail: xiaor@pku.edu.cn Tel: (86)--67-7. Fax: (86)--676-7.

Supplemental Material SUPPLEMENTAL FIGURES Supplemental Fig. Correlation between telemetric and cuff BP. Systolic blood pressure (a) and diastolic blood pressure (b) of monkeys with telemetric implants ( control normotensive and 7 metabolic syndrome hypertensive) measured simultaneously with a mercury sphygmomanometer (cuff) and telemetry min after anesthesia with ketamine ( mg/kg, i.m.). Supplemental Fig. Plasma concentrations of potassium (a), TCh (b), TG (c), ALT and AST (d), urea (e), and creatinine (f) of MetS hypertensive (n = 7) monkeys at baseline, treated with Eplerenone for days ( mg/kg/day, p.o., once a day) and washed out for days. Data are expressed as mean ± SEM. MetS, metabolic syndrome; TCh, total cholesterol, TG, Triglyceride; ALT, aspartate aminotransferase; AST, alanine aminotransferase. Supplemental Fig. Plasma concentrations of adiponectin (a), leptin (b), MCP- (c), and TNF-α (d) of the MetS hypertensive monkeys at baseline and after days of Eplerenone treatment. Data are expressed as mean ± SEM. MCP-, monocyte chemoattractant protein-; TNF-α, tumor necrosis factor α.

a Systolic Blood Pressure b Dias tolic Blood Pres sure Blood pressure by cuff (mmhg) y =.9x +.9 R =.967 Blood pressure by telemetry (mmhg) Blood pressure by cuff (mmhg) y =.88x +.78 R =.77 Blood pressure by telemetry (mmhg) Supplemental Figure

a b c Washout days Potassium (mmol/l)... TCh (mmol/l)... TG (mmol/l).... d e f Plasma concentration (U/L) ALT AST... Urea (mmol/l) 6... Creatine ( mol/l) 8... Supplemental Figure

a b Adiponectin (ng/ml) P =. Leptin (ng/ml) P =. c P =.89 d P =.6 MCP- (pg/ml) TNF- (pg/ml) Supplemental Figure

Supplemental Table. F value of the BP Circadian Rhythm in Control Normotension and MetS Hypertension Monkeys Group Animal ID# SBP DBP MBP HR.6 Control normotension.6.6 MetS hypertension.7 6.69 7 MetS indicates metabolic syndrome; SBP, systolic blood pressure; DBP, diastolic blood pressure; MBP, mean blood pressure; HR, heart rate.

Supplemental Table. F value of the BP Circadian Rhythm before and after Eplerenone treatment in MetS Hypertension Monkeys Group Animal ID# SBP DBP MBP HR.9.6.9. 6.69 7.8 Eplerenone.9 6.67 7 MetS indicates metabolic syndrome; SBP, systolic blood pressure; DBP, diastolic blood pressure; MBP, mean blood pressure; HR, heart rate.