Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Similar documents
Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Protocol for Western Blo

Protocol for Gene Transfection & Western Blotting

The Schedule and the Manual of Basic Techniques for Cell Culture

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supporting Information

Supplementary Information

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.

Anti-Lamin B1/LMNB1 Picoband Antibody

Mouse Anti-OVA IgM Antibody Assay Kit

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Mouse Total IgA Antibody Detection Kit

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

PRODUCT INFORMATION & MANUAL

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

RayBio KinaseSTAR TM Akt Activity Assay Kit

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

Supplemental Material:

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

SUPPLEMENTARY INFORMATION

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Supplemental Information

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Supplementary Information

10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)

CD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma

Sipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supporting Information

Validation of the Efficacy of a Practical Method for Neutrophils Isolation from Peripheral Blood

Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis

SUPPLEMENTARY INFORMATION

STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

Supplementary data Supplementary Figure 1 Supplementary Figure 2

HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

ab65311 Cytochrome c Releasing Apoptosis Assay Kit

Supplementary Materials for

Supplementary Figure 1

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

Cell Lysis Buffer. Catalog number: AR0103

Effect of ST2825 on the proliferation and apoptosis of human hepatocellular carcinoma cells

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung

Supplementary Materials and Methods

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Human Apolipoprotein A1 EIA Kit

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

SUPPLEMENT. Materials and methods

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

Protein MultiColor Stable, Low Range

ISOLATION OF EXFOLIATED SOMATIC CELLS FROM BUFFALO MILK

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

colorimetric sandwich ELISA kit datasheet

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

NF-κB p65 (Phospho-Thr254)

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

FOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences

EGFR (py1045)/ Pan EGFR (Human) ELISA Kit

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

Dissected tissues were minced and lysed in lysis buffer (1x Tris buffered saline (TBS), 1% NP-40,

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2

Human Urokinase / PLAU / UPA ELISA Pair Set

RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit

STAT1 (ps727) (Human/Mouse) ELISA Kit

Transcription:

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity, MSc, Ulaganathan Mabalirajan, MBBS, PhD, Kausik Chakraborty, PhD, Balaram Ghosh, PhD, Anurag Agrawal, MD, PhD ONLINE DATA SUPPLEMENT

Nebulization Details All the nebulizer solutions were made in saline and nebulized at 4 µl/sec into a plexiglass exposure chamber (4 liters) with a bias flow rate of 10 5 µl/sec (6 L/min). The estimated amount of OVA and drugs delivered to a mouse were well within accepted ranges (assuming deposition fraction 15%; OVA dose would be ~15 µg per mouse and highest doses of TMAO, glycerol, trehalose and 4-PBA would correspond to not more than 6, 9, 12 and 0.2 mg/kg respectively). Two-fold higher doses than these were found to be safe in naïve mice when administered as aerosols (Figure S1). Enzyme-linked immunosorbent assay (ELISA) Sandwich ELISA kits for mouse IL-4, IL-5, IL-13, IgE and IgG2a were purchased from BD Biosciences, USA and was performed as per manufacturer s protocol using 20 µg lung lysate (for IL-4, IL-5, IL-13), 5 µl sera (for IgE and IgG2a) or 5 µl bronchoalveolar lavage (BAL) fluid (for MUC5AC ELISA & Leishman stain) as per requirement. Western blots Lung lysate were prepared by mechanical crushing at 4 C in RIPA buffer with PI cocktail and DTT. Protein content was estimated using Bicinchoninic acid assay (Sigma) and 50 μg samples were loaded in 10% SDS PAGE with 1X protein loading dye (Fermentas, Canada). After completion of electrophoresis, protein in the gel was transferred to 0.2 μm pore sized PVDF membrane (Millipore, MA). After blocking (with 2% skimmed milk & 3% BSA in TBST), the blots were probed with primary antibody (1:1000) and followed by secondary antibody (1:2000) with intermittent washing in 0.05% TBST. After final washes blots were developed using DAB.

All other chemicals were purchased from Sigma, St. Louis. Antibodies and their isotype controls against GRP94, BiP, Caspase-12 and CHOP, β-actin were purchased from Cell Signaling Technologies and Santa Cruz Biotechnology Inc. HRP-labeled secondary antibodies against mouse, rabbit and goat immunoglobulin were purchased from Banglore Genei, India. Quantitative densitometry for the western blots was done by utilizing ImageJ software in grey scaled images and band intensities were plotted after normalizing with loading control (β-actin) intensity from the same sample. Immuno histochemistry (IHC) IHC was performed to assess the localization and differential expression of different ER-stress markers in lung tissue sections as previously described (28). Briefly, deparaffinised and rehydrated slides were subjected to antigen retrieval in citrate buffer, blocked and were incubated with primary antibody/isotype control for overnight at 4 C followed by secondary antibody and developed with 3,3-diaminobenzidine (DAB) system with intermittent washing after each step. Thereafter, slides were mounted with distyrene-plasticizer-xylene (DPX) and visualized under inverted microscope. Apoptosis To assess apoptosis, DeadEnd tm colorimetric Terminal deoxynucleotidyl transferase dutp nick end labeling (TUNEL) assay (Promega, Madison, USA) was performed as per product manual. Absolute differential leukocyte count (DLC) Lungs were sufficiently inflated post AHR assessment and then the same canula was used to

collect BAL fluids as described previously (3). This collected BAL fluid (total 1 ml approx. extracted) was washed twice in PBS & the pallet was resuspended in 50ul PBS. Thereafter, 10ul of this cell suspension was mixed with 10ul of trypan blue dye to exclude dead cells and 10ul of this mix was assessed on hemocytometer to calculate total leukocyte count (TLC). Another 10 ul of cell suspension was used to perform DLC on Leishman (Qauligen, FL, USA) stained slides under the light microscope by an expert, blindfolded to samples. Briefly these slides were prepared by 10ul of cell suspension that was smeared, air dried and methanol fixed followed by Leishmann staining as per manufacturer s protocol. Absolute differential leukocyte count for each sample was calculated by multiplying TLC and DLC.

Table S1: Mean absolute differential leukocyte count in 1 ml BAL fluids for n=5 in each group as determined by Leishman staining in experiments shown in Figure 3. Lymphocyte Monocyte Neutrophil Eosinophils SHAM 29133 ± 3558.39 99667 ± 13455.06 13800 ± 1951.72 10733 ± 1241.96 OVA 119368 ± 22185.78 97263 ± 19980.21 17684 ± 3805.72 207789 ± 36587.12 Glycerol 67907 ± 9730.26 99032 ± 15683.8 31124 ± 5163.86 84884 ± 11522.71 Trehalose 39082 ± 6441.34 91958 ± 16751.54 20691 ± 3948.66 78164 ± 12204.65 TMAO 31832 ± 3920.71 87537 ± 11916.74 4775 ± 680.99 35015 ± 4085.76 Data are expressed as mean ± standard deviation

Table S2: Mean absolute differential leukocyte count in 1 ml BAL fluids for n=5 in each group as determined by Leishman staining in experiments shown in Figure 4 & 5. Lymphocyte Monocyte Neutrophil Eosinophils SHAM 26600 ± 3249 91000 ± 12285.01 12600 ± 1782 9800 ± 1134 OVA 151200 ± 18468.02 123200 ± 16632.02 22400 ± 3168 263200 ± 30456.03 T1 113297 ± 21057.42 160808 ± 33033.92 25583 ± 5505.63 65785 ± 11583.31 T2 42737 ± 6123.7 87183 ± 13807.26 20514 ± 3403.53 20514 ± 2784.71 T3 50577 ± 8335.9 108935 ± 19844.16 25288 ± 4825.95 9726 ± 1518.63 P1 45272 ± 5576.09 94316 ± 12839.6 16977 ± 2421.2 32067 ± 3741.77 P2 32480 ± 4654 90602 ± 14348.73 6838 ± 1134.51 41027 ± 5569.28 P3 22046 ± 3633.54 79107 ± 14410.54 2594 ± 495.04 25937 ± 4049.84 Data are expressed as mean ± standard deviation

Figure S1: Different chemical chaperones delivered to naïve mice were inert on asthmatic features at indicated concentrations. (A) Airway hyperresponsiveness and (B) micrographs of representative hematoxylin and eosin staining from naïve mouse delivered with chemical chaperone at highest concentration used in the manuscript. Figure S2. Representative Immuno-histochemistry for different ER stress markers and dead cell assay (TUNEL) in the lung sections from SHAM & OVA mouse. Figure S3. (A) Densitometry score of western blots for ER stress parameters shown in Figure 3B. (B) Elisa for allergic inflammation parameters viz IgE, IgG2a, IL-4 & IL13 normalized to SHAM in the same experiment. (*) indicates statistical significance (P<0.05) for n=5, relative to OVA group. Figure S4. (A) Densitometry score of western blots for ER-stress parameters shown in Figure 4C & 5C. (B) & (C) ELISA for different allergic inflammation parameters viz. IgE, IgG2a, IL-4, IL-5 & IL13 in the same experiments. (*) indicates statistical significance (P<0.05) and NS, statistically non significant, for n=5, compared to OVA group.