1 Table S1 Wheat VIT genes identified in this study Rice ortholog Rice gene ID a Wheat gene name b Wheat gene ID c % amino acid identity to closest rice orthologue TaVIT1-A TRIAE_CS42_2AL_TGACv1_094675_AA0301300 86.6 OsVIT1 LOC_Os04g38940 TaVIT1-B TRIAE_CS42_2BL_TGACv1_129586_AA0389520 87.0 TaVIT1-D TRIAE_CS42_2DL_TGACv1_159145_AA0533310 86.6 TaVIT2-A TRIAE_CS42_5AL_TGACv1_374137_AA1191460 86.9 OsVIT2 LOC_Os09g23300 TaVIT2-B TRIAE_CS42_5BL_TGACv1_406234_AA1342560 86.9 2 3 4 5 6 TaVIT2-D TRIAE_CS42_5DL_TGACv1_433496_AA1414720 86.9 a Rice gene ID from MSU Rice Genome Annotation Project Database and Resource, http://rice.plantbiology.msu.edu/, accessed 18 November 2016. b Names given in this study. c Wheat gene ID from EnsemblPlants, http://plants.ensembl.org/, accessed 18 November 2016. 7 1
Table S2 Expression analysis of TaVIT genes (a) Details of data sets used in analysis (Source: http://www.wheat-expression.com). 8 9 10 Category Study Age High level age High level stress-disease High level tissue High level variety Stress-disease Tissue Variety Continued on next page Data sets included in analysis phosphate starvation in roots and shoots, fusarium head blight infected spikelets, grain tissue-specific developmental timecourse, flag leaf downregulation of GPC, grain tissuespecific developmental timecourse, stripe rust infected seedlings, Septoria tritici infected seedlings, shoots and leaves of nulli tetra group 1 and group 5, grain tissue-specific developmental timecourse, comparison of stamen, pistil and pistilloidy expression, stripe rust and powdery mildew timecourse of infection in seedlings, developmental time-course of synthetic hexaploid, grain tissue-specific expression at 12 days post anthesis, drought and heat stress time-course in seedlings, developmental time-course of Chinese Spring, grain developmental timecourse with 4A dormancy QTL, 7 days, seedling stage, 14 days, three leaf stage, 24 days, tillering stage, fifth leaf stage, 1 cm spike, two nodes detectable, flag leaf stage, anthesis, 2 dpa, 4 dpa, 6 dpa, 8 dpa, 9 dpa, 10 dpa, 11 dpa, 12 dpa, 4-12 dpa, 14 dpa, 15 dpa, 20 dpa, 25 dpa, 30 dpa, 35 dpa, seedling, vegetative, reproductive, no stress, disease, abiotic, transgenic, spike, grain, leaves/shoots, roots, Chinese Spring, other, Nullitetra Chinese Spring, none, mock inoculation 30 hours, mock inoculation 50 hours, Fusarium graminearum inoculation 30 hours, Fusarium graminearum inoculation 50 hours, stripe rust pathogen CYR31 24 hours, stripe rust pathogen CYR31 48 hours, stripe rust pathogen CYR31 72 hours, stripe rust mixture 6/14 days, Powdery mildew pathogen E09 24 hours, Powdery mildew pathogen E09 48 hours, Powdery mildew pathogen E09 72 hours, Septoria tritici 4 days, Septoria tritici 10 days, Septoria tritici 13 days, 1 hour of drought stress, 6 hour of drought stress, 1 hour of heat stress, 6 hour of heat stress, 1 hour of drought&heat combined stress, 6 hour of drought&heat combined stress, Phosphorous starvation 10 days, GPC RNAi, grain, whole endosperm, starchy endosperm, aleurone layer and starchy endosperm, starchy endosperm + seed coat, seed coat, aleurone layer, transfer cells, pistil, pistillody stamen, stamen, spike, spikelets (only using palea, lemma and rachis), seedling, shoots, leaves, 2nd leaf, flag leaf, stem, roots, Chinese Spring, Holdfast, TAM107, Banks, Avocet S, Sevin, Bobwhite, GPC RNAi Bobwhite, P271, Chinese Spring NIL CSTP, HTS-1, N9134, synthetic hexaploid (mother Triticum turgidum ssp dicoccon accession PI94655, father Aegilops tauschii ssp strangulata accession AS2404), CM-82036, NIL1 from CM-82036 BC5 in Remus, NIL2 from CM-82036 BC5 in Remus, NIL3 from CM-82036 BC5 in Remus, NIL4 from CM- 82036 BC5 in Remus, Baxter -4A dormancy QTL, Chara -4A dormancy QTL, Westonia -4A dormancy QTL, Yipti +4A dormancy QTL, NIL 0362 +4A dormancy QTL, NIL 0807 +4A dormancy QTL, NIL 1038 +4A dormancy QTL, NIL 1275 +4A dormancy QTL, NIL 1516 +4A dormancy QTL, NIL 0807-4A dormancy QTL, NIL 1038-4A dormancy QTL, NIL 1275-4A dormancy QTL, NIL 0362-4A dormancy QTL, NIL 1516-4A dormancy QTL, Chinese Spring, N1AT1B, Chinese Spring, N1AT1D, Chinese Spring, N1BT1A, Chinese Spring, N1BT1D, Chinese Spring, N1DT1A, Chinese Spring, N1DT1B, Chinese Spring, N5AT5B, Chinese Spring, N5AT5D, Chinese Spring, N5BT5A, Chinese Spring, N5BT5D, Chinese Spring, N5DT5A, Chinese Spring, N5DT5B, 2
11 (b) Transcript levels of TaVIT1 homoeologues in different tissues Tissue Mean TPM a SEM Mean TPM a SEM Mean TPM a SEM 2nd leaf 8 3.339 0.516 2.484 0.397 9.288 1.146 Aleurone layer 12 10.520 1.997 7.854 1.688 12.429 2.623 Aleurone layer and starchy endosperm 4 3.074 1.246 2.465 0.986 2.723 0.879 Flag leaf 7 0.760 0.056 0.828 0.105 3.682 0.372 Grain 97 2.674 0.141 1.929 0.155 2.326 0.132 Leaves 43 3.766 0.460 1.879 0.210 8.799 1.174 Roots 70 7.257 0.295 7.760 0.183 15.752 0.558 Seed coat 6 0.235 0.126 0.185 0.130 0.113 0.074 Seedling 3 3.687 0.264 2.861 0.512 5.554 1.491 Shoots 62 2.256 0.112 1.799 0.113 6.813 0.498 Spike 13 1.173 0.175 0.920 0.121 2.163 0.314 Spikelets 60 0.630 0.037 0.860 0.032 3.793 0.171 Starchy endosperm number of replicates TRIAE_CS42_2AL_TGACv1 _094675_AA030130 TRIAE_CS42_2BL_TGACv1 _129586_AA038952 TRIAE_CS42_2DL_TGACv1_ 159145_AA053331 b 17 0.654 0.157 0.493 0.091 0.514 0.112 Stem 7 3.083 0.952 2.777 0.924 4.691 1.897 Transfer cells 4 1.687 0.427 0.871 0.184 1.597 0.464 12 a Values of 2 TPM and below are considered very low levels of gene expression (Borrill et al, Plant 13 14 15 16 Physiol 170, 2172-2186 (2016). b Values are the sums of two transcript variants: TRIAE_CS42_2DL_TGACv1_159145_AA053331.1 and TRIAE_CS42_2DL_TGACv1_159145_AA053331.2. 17 (c) Transcript levels of TaVIT2 homoeologues in different tissues Tissue Mean TPM a SEM Mean TPM a SEM Mean TPM a SEM 2nd leaf 8 1.411 0.858 1.018 0.193 0.962 0.388 Aleurone layer 12 24.584 7.550 20.381 4.573 16.569 3.757 Aleurone layer and starchy endosperm 4 3.670 0.720 5.561 1.192 5.688 1.886 Flag leaf 7 15.601 2.119 8.552 0.785 10.520 1.299 Grain 97 3.519 0.233 3.295 0.126 2.766 0.141 Leaves 43 12.283 1.746 8.924 1.320 18.638 2.704 Roots 70 39.807 2.943 40.920 2.890 28.697 2.122 Seed coat 6 0.175 0.085 1.341 0.431 0.949 0.247 Seedling 3 9.177 1.277 6.922 0.784 9.823 3.510 Shoots 62 16.838 2.203 19.786 2.363 14.811 1.592 Spike 13 7.684 1.025 5.882 0.834 10.658 1.823 Spikelets 60 36.564 2.095 39.593 1.812 45.598 2.104 Starchy endosperm number of replicates TRIAE_CS42_5AL_TGACv1 _374137_AA1191460 TRIAE_CS42_5BL_TGACv1 _406234_AA1342560 TRIAE_CS42_5DL_TGACv1_ 433496_AA1414720 17 0.726 0.178 1.899 0.519 2.044 0.546 Stem 7 18.052 6.224 6.702 1.745 12.601 2.655 Transfer cells 4 2.172 0.781 1.923 0.562 1.275 0.308 18 a Values of 2 TPM and below are considered very low levels of gene expression (Borrill et al, Plant 19 20 Physiol 170, 2172-2186 (2016). 3
21 22 Table S3 Element analysis of control and HMW-TaVIT2 wheat lines. Asterisks denote statistically significant differences from the control determined by Kruskal-Wallis test with Dunnett post-hoc test. * p < 0.05, ** p < 0.01. Fe (μg / g) P (μg / g) Mg (μg / g) Zn (μg / g) Mn (μg / g) Line White Wholemeal White Wholemeal White Wholemeal White Wholemeal White Wholemeal 21-29 10.1 ± 0.3 20.3 ± 2.1 1231 ± 17 2985 ± 266 334 ± 7 1108 ± 106 11.2 ± 0.2 22.6 ± 1.7 16.9 ± 0.1 35.2 ± 2.3 Control 22-15 9.2 ± 0.1 29.3 ± 1.1 1114 ± 7 3167 ± 157 247 ± 0 1016 ± 63 10.1 ± 0.3 26.5 ± 1.1 12.3 ± 0.1 31.3 ± 0.9 21-18 10.0 ± 0.5 22.5 ± 0.4 1198 ± 22 2992 ± 92 311 ± 4 1085 ± 11 10.5 ± 0.3 23.0 ± 0.4 19.5 ± 0.5 41.0 ± 0.8 Mean ± SEM 9.7 ± 0.3 24.0 ± 2.7 1181 ± 35 3048 ± 59 297 ± 25.8 1070 ± 27 10.6 ± 0.3 24.0 ± 1.2 16.2 ± 2.1 35.8 ± 2.8 22-16 29.1 ± 3.3 22.4 ± 0.3 1578 ± 42 3751 ± 70 434 ± 18 1309 ± 15 13.2 ± 0.2 24.3 ± 0.2 17.9 ± 0.6 34.3 ± 0.7 1 copy 22-14 22.2 ± 3.0 25.9 ± 1.0 1498 ± 153 3780 ± 177 400 ± 51 1280 ± 66 12.7 ± 1.5 28.4 ± 1.0 18.6 ± 2.0 43.3 ± 1.6 22-11 17.6 ± 0.6 22.4 ± 1.3 1346 ± 70 3405 ± 90 303 ± 16 1033 ± 21 8.3 ± 0.6 18.7 ± 1.3 13.1 ± 1.2 30.3 ± 1.8 86-29 17.9 ± 1.2 25.9 ± 1.6 1412 ± 47 3613 ± 199 352 ± 16 1173 ± 67 15.5 ± 0.4 34.3 ± 2.6 16.3 ± 0.4 44.1 ± 3.4 Mean ± SEM 21.7 ± 2.7* 24.2 ± 1.0 1459 ± 50* 3637 ± 86* 372 ± 28.7 1199 ± 62 12.4 ± 1.5 26.4 ± 3.3 16.5 ± 1.2 38.0 ± 3.4 22-19 18.7 ± 0.9 28.0 ± 1.1 1257 ± 44 3038 ± 42 332 ± 12 1044 ± 24 10.7 ± 0.7 23.8 ± 0.9 13.4 ± 2.0 27.6 ± 3.8 8 16 copies 22-05 16.5 ± 0.6 19.9 ± 0.4 1329 ± 52 3511 ± 143 329 ± 17 1151 ± 27 12.0 ± 0.7 24.7 ± 1.3 14.4 ± 2.1 29.9 ± 4.8 22-01 18.3 ± 3.7 19.6 ± 1.3 1297 ± 102 3039 ± 17 332 ± 44 1020 ± 6 11.5 ± 1.5 21.6 ± 0.2 14.2 ± 3.2 23.6 ± 2.3 Mean ± SEM 17.9 ± 0.7* 22.5 ± 2.7 1294 ± 21 3196 ± 158 331 ± 1.2 1072 ± 40 11.4 ± 0.4 23.3 ± 0.9 14.0 ± 0.3 27.0 ± 1.9 22-10 35.2 ± 0.2 44.6 ± 0.6 1935 ± 58 4511 ± 59 464 ± 8 1326 ± 13 26.8 ± 0.5 60.6 ± 1.4 21.3 ± 0.1 52.1 ± 1.6 20 copies 21-30 22.6 ± 0.3 28.7 ± 1.0 1201 ± 14 3107 ± 86 305 ± 1 1102 ± 31 11.1 ± 0.2 25.9 ± 0.4 12.6 ± 0.2 32.0 ± 0.8 22-04 44.8 ± 0.7 51.2 ± 1.5 2152 ± 20 4450 ± 16 595 ± 11 1467 ± 0 38.9 ± 0.8 75.0 ± 0.8 30.4 ± 0.7 65.0 ± 0.1 23 Mean ± SEM 34.2 ± 6.4* 41.5 ± 6.7** 1763 ± 288** 4023 ± 458** 455 ± 83.9 1298 ± 106* 25.6 ± 8.1 53.9 ± 14.6* 21.4 ± 5.1 49.7 ± 9.6 24 4
25 26 27 Table S4 Heavy metals in control and HMW-TaVIT2 wheat lines. Asterisks denote statistically significant differences from the control determined by Kruskal-Wallis test with Dunnett post-hoc test. * p < 0.05, ** p < 0.01. Line Cd (ng / g) Pb (ng / g) White Wholemeal White Wholemeal 21-29 23.8 ± 0.2 33.4 ± 0.5 18.6 ± 2.3 16.0 ± 6.0 Control 22-15 32.1 ± 9.8 34.9 ± 2.2 35.5 ± 16.3 13.4 ± 0.4 21-18 23.4 ± 0.6 41.2 ± 6.1 19.2 ± 0.0 38.0 ± 14.6 Mean ± SEM 26.5 ± 2.8 36.5 ± 2.4 24.5 ± 5.5 22.5 ± 7.8 22-14 30.8 ± 2.2 47.2 ± 0.4 40.9 ± 4.5 13.9 ± 0.3 1 copy 22-11 22.6 ± 1.6 59.5 ± 10.5 26.2 ± 5.4 18.4 ± 3.6 86-29 26.8 ± 0.2 41.4 ± 3.7 22.4 ± 2.8 18.0 ± 0.6 Mean ± SEM 26.7 ± 2.7 49.4 ± 3.5 29.8 ± 6.5 16.8 ± 8.1 22-10 44.4 ± 8.0 51.2 ± 0.4 28.3 ± 2.9 20.8 ± 2.3 20 copies 21-30 33.2 ± 0.3 67.0 ± 14.6 56.1 ± 33.3 11.9 ± 0.7 22-04 32.9 ± 2.6 47.3 ± 2.1 30.9 ± 7.3 16.2 ± 1.1 Mean ± SEM 36.8 ± 2.6* 55.2 ± 5.4** 38.4 ± 6.4 16.3 ± 7.4 28 29 30 31 5
Copy number of HMW-TaVIT2 transgene Plant ID Number of tillers Total grain number Thousand grain weight (g) Grains per ear b Grain area c (mm 2 ) Grain width c (mm) Grain length c (mm) 32 33 34 Table S5 Architectural and yield components of control and HMW-TaVIT2 T 0 transformants a. Asterisk denotes statistically significant difference (* p < 0.05) from the control determined by one-way ANOVA with Tukey post-hoc test. 0 11-01 13 468 45.8 36.0 17.3 3.3 6.7 0 21-18 10 509 46.0 50.9 16.8 3.4 6.3 0 21-29 10 504 47.7 50.4 17.5 3.4 6.7 0 21-72 16 84 46.2 5.3 19.3 3.5 7.2 0 22-15 9 378 52.3 42.0 18.6 3.5 7.0 0 22-17 9 396 52.5 44.0 19.4 3.5 7.5 0 22-18 11 444 49.1 40.4 18.4 3.5 6.8 0 22-21 10 374 51.6 37.4 18.4 3.5 6.9 0 22-22 10 349 52.0 34.9 19.1 3.5 7.3 Average ± SEM 10.9 ± 0.8 390 ± 43 49.2 ± 1.0 37.9 ± 4.5 18.3 ± 0.3 3.5 ± 0.0 6.9 ± 0.1 1 10-01 17 379 42.8 22.3 16.5 3.3 6.6 1 11-02 13 396 47.5 30.5 17.3 3.3 6.8 1 11-04-2 13 394 47.1 30.3 17.7 3.4 6.7 1 22-09 14 538 50.4 38.4 18.2 3.6 6.7 1 22-10-2 12 301 51.8 25.1 19.5 3.6 7.0 1 22-11 6 204 53.0 34.0 19.0 3.5 7.0 1 22-14 19 357 51.3 18.8 18.1 3.5 6.7 1 22-16 15 413 47.4 27.5 18.0 3.4 6.8 1 86-29 16 283 44.7 17.7 17.4 3.3 7.0 1 86-46 11 421 42.1 38.3 16.3 3.2 6.7 Average ± SEM 13.6 ± 1.1 369 ± 29 47.8 ± 1.2 28.3 ± 2.3 17.8 ±0.3 3.4 ± 0.0 6.8 ± 0.1 2 21-17 11 495 45.8 45.0 17.6 3.3 6.9 2 22-08 16 476 49.1 29.8 17.9 3.5 6.6 3 11-04 15 434 49.2 28.9 18.1 3.4 6.9 4 21-62 12 520 49.9 43.3 18.0 3.4 6.8 7 21-63 13 510 49.9 39.2 17.8 3.5 6.7 8 22-19 18 477 43.9 26.5 16.7 3.3 6.5 14 22-05 21 471 47.3 22.4 17.3 3.3 6.7 14 86-53 12 492 35.6 41.0 15.1 3.0 6.6 16 22-01 20 576 45.2 28.8 16.9 3.3 6.7 Average ± SEM 15.3 ± 1.2* 495 ± 13 46.2 ± 1.5 33.9 ± 2.8 17.3 ± 0.3 3.3 ± 0.1 6.7 ± 0.0 20 21-30 12 411 48.3 34.3 17.8 3.4 6.7 20 21-74 12 439 51.8 36.6 18.3 3.5 6.8 20 22-04 12 58 42.2 4.8 17.7 3.4 7.0 25 86-60 12 340 32.7 28.3 15.4 3.0 6.8 28 22-10 11 94 51.8 8.5 21.0 3.6 7.6 30 11-03 12 437 45.2 36.4 17.2 3.3 6.7 Average ± SEM 11.8 ± 0.2 297 ± 71 45.3 ± 3.0 24.8 ± 5.9 17.9 ± 0.7 3.4 ± 0.1 6.9 ± 0.1 35 36 37 38 a Plants were grown in a controlled environment room. b Values are the mean of all ears produced per plant. c Values are the mean of all grains produced per plant. 6
39 40 Table S6 Architectural and yield components of T 1 plants segregating from a TaVIT2 over-expressor T 0 plant HMW-TaVIT2 segregant a (n = 47) Null segregant a (n = 11) Negative control (n = 25) 41 42 43 44 45 46 47 48 49 50 51 52 53 Plant height (cm) 46.7 ± 0.5 47.3 ± 1.5 51.6 ± 0.6 Tillers per plant c 7.7 ± 0.3 7.0 ± 0.7 6.8 ± 0.4 Grain number per plant c 158.9 ± 6.7 154.8 ± 12.4 140.2 ± 6.9 Thousand grain weight (g) c 24.2 ± 0.6 24.1 ± 1.9 23.0 ± 0.8 Grain number per ear 20.8 ± 0.5 23.1 ± 1.7 21.2 ± 0.7 Grain area (mm 2 ) 11.9 ± 0.1 11.7 ± 0.5 12.3 ± 0.2 Grain length (mm) 5.6 ± 0.02 5.4 ± 0.1 6.0 ± 0.04 Grain width (mm) 2.7 ± 0.03 2.7 ± 0.1 2.6 ± 0.03 Iron, white flour d (ppm) 40.1 ± 1.2* 21.7 ± 0.2* 21.1 ± 1.8 Iron, wholemeal flour d (ppm) 43.9 ± 0.3 41.9 ± 0.6 49.3 ± 2.2 Values are the means ± SEM of plants grown in a glasshouse. Note, the iron concentrations differ from those of plants grown in controlled environment rooms, but they show the same trend. Unpaired Student s t-tests showed no significant differences for any of the growth parameters between HMW-TaVIT2 segregants and sibling null segregants (p > 0.05 in all cases). * Mean iron content of white flour was higher in HMW-TaVIT2 segregants than null segregants (unpaired Student s t-test, p < 0.05). a The presence or absence (in the case of null segregants) was confirmed by PCR for the HYGROMYCIN marker gene. b Untransformed wheat (var. Fielder) was used as a negative control. c Note low numbers for these values was due to stressful growth conditions in the glasshouse including poor light levels and overheating. d Flour milled from grains pooled from 5 individual plants. 54 55 7
56 Table S7, list of primers 1 Primer name Primer sequence (5 to 3 ) 57 HAT-EcoRI-F HAT(Stop)-ClaI-R Hyg-F Hyg-R qrt-hkg-f qrt-hkg-r qrt-tavit2-f qrt-tavit2-r ScCCC1-BamHI-F ScCCC1-EcoRI-R ScFET3-XbaI-F ScFET3-XhoI-R ScPMR1-SpeI-F ScPMR1-XhoI-R ScZRC1-XbaI-F ScZRC1-EcoRI-R TaVIT1co-XbaI-F TaVIT1co-EcoRI-R TaVIT2-BamHI-F TaVIT2-NcoI-F TaVIT2-SpeI-R TaVIT2(ns)-EcoRI-R AAGTAGAATTCGCAGGCGGCCGCATC GAATAATCGATAAGCTTTCAGCGGCCGCAC ATGAAAAAGCCTGAACTCACC CTATTCCTTTGCCCTCGGA CGGGCCCGAAGAGAGTCT ATTAACGAAACCAATCGACGGA CTCCCCCTACATGTTCGT CCCTTGACGTAGCCGAA AAAGGATCCATGTCCATTGTAGCACTAAAG AATATGAATTCTTAACCCAGTAACTTAACAAAG GATGGTCTAGAATGACTAACGCTTTGCTCTC GACCCTCGAGTTAGAAGAACCGTTTGGCTTTAG AAAACTAGTATGAGTGACAATCCATTTAATG AAAACTCGAGTCAAACATTTGAGAAATACG AAATCTAGAATGATCACCGGTAAAGAATTGAG AATATGAATTCTTACAGGCAATTGGAAGTATTG AGTCTAGAATGGATGGTCATGGTGAC AGTCAGAATTCTCATCTTGCTTGAAC ATAGGATCCATGGTGAAGCCTGTG AGACCATGGTGAAGCCTGTGCAG TGAACTAGTCAGATGGCCTGCACG GAATAGAATTCGATGGCCTGCACGGCCTTG 58 1 Restriction sites, where present, are underlined. 8