TRPM8 in the negative regulation of TNFα expression during cold stress

Similar documents
The subcortical maternal complex controls symmetric division of mouse zygotes by

Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54

Canqiu Yu 1, Jinwei Chen 2, Li Huang 3*

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Researches on Fermentation Engineering of Polysaccharide of

Supplementary information

Supplemental Information

Supporting Information

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

SUPPLEMENTARY INFORMATION

EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE II

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Summary of Chapter 44 of the Líng Shū

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

Liu Jing and Liu Jing Diagnosis System in Classical TCM Discussions of Six Divisions or Six Confirmations Diagnosis System in Classical TCM Texts

Effect of EGCG in combination with gemcitabine on β-catenin expression in PANC-1 human pancreatic cancer cells * Research Article

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese

Diagnostic Accuracy of Intracellular Mycobacterium. tuberculosis Detection for Tuberculous Meningitis

Phase IV clinical trial of Shufeng Jiedu Capsule in the treatment of cases of acute upper espiratory infection of wind-heat syndrome

Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *

Supporting information

A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

Supplementary Materials

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Figure S1

Appropriate Quality regarde as

AVINASH CHANDRA, MD. September 16 th, Business Address: Buffalo Neuroimaging Analysis Center

TCM Ideology and Methodology

Bioinformatics Analysis on Molecular Mechanism of Poria Cocos in Treatment of Jaundice

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Rapid Detection of Milk Protein based on Proteolysis Catalyzed by Trypsinase

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS

SUPPLEMENTARY FIGURES

Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Chinese Journal of Experimental Traditional Medical Formulae 14 ~ ~ 20 P < 0. 05

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Title: Expression of AE1/p16 promoted degradation of AE2 in gastric cancer cells

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice

Cell Death in Biology and Diseases

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplementary Figure S1 Supplementary Figure S2

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

SUPPLEMENTAL FIGURE LEGENDS

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

CURRICULUM VITAE. Professional Employment and Teaching Experience:

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Effect of Ginkgo biloba leaf extract on electroencephalography of rat with cerebral ischemia and reperfusion

ACTA PHYSIOLOGICA SINICA

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Root & Branch Bulk Formula List

Supplementary Information

Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via. Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid.

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Supplementary methods:

Low toxicity and accumulation of zinc oxide nanoparticles in mice

Supplementary Figure 1

Integrative network analysis: Bridging the gap between Western medicine and traditional Chinese medicine

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

SPIE Student Chapter Report Annual report

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity

Effect of Chronic Aluminum Exposure on PKC, CaMK and Neurogranin in Hippocampus of Rat

Supplementary Figure 1. mir124 does not change neuron morphology and synaptic

Joint Department of Biomedical Engineering

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Used for exterior conditions such as common colds, fevers, and flu s. Many of these formulas induce sweating. This category can be subdivided into

Transcription:

in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1* 1 MOE Key Laboratory of Protein Sciences, Laboratory of Molecular Pharmacology and Pharmaceutical Sciences, School of Life Sciences, Tsinghua University, Beijing 100084, China 2 School of Pharmacology and Pharmaceutical Sciences, Tsinghua University, Beijing 100084, China Equal in contribution * Correspondence should be addressed to MOE Key Laboratory of Protein Sciences, Laboratory of Molecular Pharmacology and Pharmaceutical Sciences School of Life Sciences Tsinghua University, Beijing 100084, China Tel: +86-10-62796270 Email: lijundu@mail.tsinghua.edu.cn Supplementary information includes: Supplementary Figure S1-S11, Table S1 and S2.

Supplementary information Figure S1 Figure S1. Comparison of the mrna expressions of, TRPA1, TNFα and of PC12 cells in between 20 C and 4 C conditions. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.

Figure S2 34.5 C TNFα 30 C Control Model Control Model Control Model TNFα 20 C Control Model Control Model Control Model TNFα * * * 4 C Control Model Control Model Control Model TNFα Control Model Control Model Control Model Figure S2. The mrna expressions of, and TNFα in PC12 cells under different temperature in vitro. Control: 37 C. Model: Cold conditions. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.

Figure S3 Figure S3. The mrna expressions of, HSP70, and TNFα in heat stress (40 C) both in vivo and in vitro. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.

Figure S4 Figure S4. Effect of Trpm8siRNA and Trpa1siRNA (sirna) on the mrna expressions of, TRPA1, TNFα and in PC12 cells in normal conditions (37 C). (A) - (D): Trpm8siRNA. (E) - (H): Trpa1siRNA. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.

Figure S5 Figure S5. Effect of Trpm8siRNA (sirna) on the mrna expressions of, TRPA1, TNFα and in PC12 cells in cold conditions (4 C). Data are shown as the mean ± S.D. from three independent experiments. **, P < 0.01.

Figure S6 Figure S6. Effect of menthol on the mrna expressions of, TRPA1, TNFα and in PC12 cells. Data are shown as the mean ± S.D. from three independent experiments. #, P < 0.05; ##, P < 0.01.

Figure S7 Figure S7. The mrna expressions of, and TNFα in ischemia and reperfusion stress under normal conditions (in vivo: room temperature, in vitro: 37 C). Con represents control, Mod means model. CIR: cerebral ischemia and reperfusion, OGD: oxygen and glucose deprivation. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.

Figure S8 Figure S8. The mrna expressions of, HSP70, and TNFα under cold stress (4 C) both in vivo and in vitro. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.

Figure S9 TRPA1 TNFα Lane1: Marker Lane2 5: TRPA1 (0 3h / 4 C) Lane1: Marker Lane2 5: TNFα (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Figure S9. Original blots of cropped western blots of Figure 1. The expression levels of, TRPA1, and TNFα in mouse brains under cold conditions.

Figure S10 TRPA1 Lane1: Positive control Lane2 5: (0 3h / 4 C) Lane1: Positive control Lane2 5: TRPA1 (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane5: Positive control Lane1 4: (0 3h / 4 C) Lane5: Positive control TNFα Lane1 4: TNFα (0 3h / 4 C) Figure S10. Original blots of cropped western blots of Figure 2. Expression of, TRPA1, and TNFα in PC12 cells under cold conditions.

Figure S11 TRPA1 Lane1 4: TRPA1 (0 3h / 4 C) Lane5: Empty Lane1 4: (0 3h / 4 C) TNFα Lane1 4: TNFα (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Figure S11. Original blots of cropped western blots of Figure 3. Expression of, TRPA1, and TNFα in PC12 cells with Trpm8 knockdown under cold conditions.

Figure S12 IP: (WT) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) Lane4: Marker Lane5: IP (0h) Lane6: IP (3h) Lane1: Input (0h) Lane2: Input (3h) Heavy Chain (Input) Lane1: Positive control Lane1: Input (0h) Lane2: Input (3h) (IP) Lane1: IP (0h) Lane2: IP (3h) IP: (WT) Lane1: Input (0h) Lane2: Input (3h) Lane4: Marker Lane3: IP (0h) Lane4: IP (3h) Lane1: IP (0h) Lane2: IP (3h) Lane1: Input (0h) Lane2: Input (3h) Lane1: Input (0h) Lane2: Input (3h) Lane3: Positive control IP: (KD) (Input) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) Lane4: Marker (Input) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) (IP) Lane1: IP (0h) Lane2: IP (3h) Lane3: Marker Lane4: Input (0h) Lane5: Input (3h) Lane6: Positive control (IP) (Input) Lane1: IP (0h) Lane2: IP (3h) IP: (KD) (IP) Heavy Chain Lane1: Marker Lane2: IP (0h) Lane3: IP (3h) (input) Lane1: Input (0h) Lane2: Input (3h) Lane1: Input (0h) Lane2: Input (3h) Lane3: Marker Lane4: IP (0h) Lane5: IP (3h) Lane1: IP (0h) Lane2: IP (3h) Lane3: positive control Figure S12. Original blots of cropped western blots of Figure 5. Co-immunoprecipitation (CoIP) of endogenous and using antibodies and reverse CoIP performed with antibodies in PC12 (WT) and (KD) respectively.

Figure S13 WT C- N- Lane1 4: in Cytoplasm (0 3 h/ 4 C) Lane5: Marker Lane6 9: in Nucleus (0 3 h/ 4 C) Lane1 4: (0 3 h/ 4 C) KD C- Lane1 4: in Cytoplasm (0 3 h/ 4 C) N- Lane1 4: in Nucleus (0 3 h/ 4 C) Lane1 4: (0 3 h/ 4 C) Figure S13. Original blots of cropped western blots of Figure 6. Protein expression of in PC12 cells under cold conditions (4 ºC).

Figure S14 TNFα Lane1: Normal Lane2: Normal+Cooling Lane3: CIR Model Lane4: CIR+Cooling Figure S14. Original blots of cropped western blots of Figure 7. Protein expression of and TNFα in mouse brain with cerebral ischemia-reperfusion (CIR)..

Table S1 Table S1 Primer for mouse Gene Sense Anti-sense TATGAGACCCGAGCAGTGGA CAGGCTGAGCGATGAAATGC TRPA1 GTCCAGGGCGTTGTCTATCG CGTGATGCAGAGGACAGAGAT GGAGGCATGTTCGGTAGTGG CCCTGCGTTGGATTTCGTG TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG AGGCCACACAAATAGGGTCC TTGTGGACACTGCCCCATTC

Table S2 Table S2 Primer for PC12 cells (rat) Gene Sense Anti-sense TCATACCCACCTGCTGCTTG CCTGGGCAAAACACACGATG TRPA1 GCAGCATTTTCAGGTGCCAA CGCTGTCCAGGCACATCTTA CGCCTGAGACCCGAGACAAG CTGCCTCCTGCTCCACTGAC TNFα CTCCAGCTGGAAGACTCCTCCCAG CCCGACTACGTGCTCCTCACC CCGTAAAGACCTCTATGCCAACA CGGACTCATCGTACTCCTGCTT

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback