Supporting information

Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction in vivo Kai Wang, a,b, Li Bao, a, b, Nan Zhou, c Jinjin Zhang, a,b Mingfang Liao, a,b Zhongyong Zheng, a,b Yujing Wang, b,c Chang Liu, c Jun Wang, d Lifeng Wang, e Wenzhao Wang, a ShuangJiang Liu, b,c Hongwei Liu a, b, * a State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing 100101, P. R. China b University of Chinese Academy of Sciences, Beijing, 100049, P. R. China c State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing 100101, P. R. China d CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing 100101, P. R. China e Beijing Kangyuan Pharmaceutical Co., Ltd., No. 3 Changliu Road, Changping District, 102200, Beijing P. R. China S1

Contents Scheme S1. Synthesis of compound 7n Figure S1. α-glucosidase reductase inhibitory activities of 7c-7f performed by HPLC method. Figure S2. The chemical stability of 7d compared with ganomycin I Figure S3. Long-term toxicity of 7d on C57BL/6J mice Figure S4. Mean plasma concentration profile of 7d in rat plasma after intragastric administration of 7d 2.0 mg/ kg in rats. Figure S5. Effects of 7d on body weight control in DIO mice. Figure S6. Effects of 7d on blood glucose levels and insulin resistance in DIO mice. Figure S7. Effects of 7d on lipid metabolism in DIO mice Figure S8. Effects of 7d on the in vivo α-glucosidase inhibitory activitys and small intestinal carbohydrate distribution. Figure S9. Transcriptome analysis of the hepatic gene expression profile in 7d-treated ob/ob mice. Figure S10. Detection of pseudo-germ-free mice treated with antibiotics (Abx). Figure S11. Antibiotics treatment blocks the therapeutic effects of 7d Figure S12. 1 H NMR spectrum of 2b (CDCl 3, 500 MHz) Figure S13. 13 C NMR spectrum of 2b (CDCl 3, 125 MHz) Figure S14. 1 H NMR spectrum of 2d (CDCl 3, 500 MHz) Figure S15. 13 C NMR spectrum of 2d (CDCl 3, 125 MHz) Figure S16. 1 H NMR spectrum of 5 (CDCl 3, 500 MHz) Figure S17. 1 H NMR spectrum of aldehyde (CDCl 3, 500 MHz) Figure S18. 1 H NMR spectrum of 6 (CDCl 3, 500 MHz) Figure S19. 1 H NMR spectrum of 7a (CDCl 3, 500 MHz) Figure S20. 13 C NMR spectrum of 7a (CDCl 3, 125 MHz) Figure S21. 1 H NMR spectrum of 7b (CDCl 3, 500 MHz) Figure S22. 13 C NMR spectrum of 7b (CDCl 3, 125 MHz) Figure S23. 1 H NMR spectrum of 7c (CDCl 3, 500 MHz) S4 S5 S6 S7 S8 S9 S10 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 S21 S22 S23 S24 S25 S26 S27 S2

Figure S24. 13 C NMR spectrum of 7c (CDCl 3, 125 MHz) Figure S25. 1 H NMR spectrum of 7d (CDCl 3, 500 MHz) Figure S26. 13 C NMR spectrum of 7d (CDCl 3, 125 MHz) Figure S27. 1 H NMR spectrum of 7e (Acetone-d 6, 500 MHz) Figure S28. 1 H NMR spectrum of 7f (CDCl 3, 500 MHz) Figure S29. 13 C NMR spectrum of 7f (CDCl 3, 125 MHz) Figure S30. 1 H NMR spectrum of 7g (CDCl 3, 500 MHz) Figure S31. 13 C NMR spectrum of 7g (CDCl 3, 125 MHz) Figure S32. 1 H NMR spectrum of 7h (CDCl 3, 500 MHz) Figure S33. 1 H NMR spectrum of 7i (CDCl 3, 500 MHz) Figure S34. 1 H NMR spectrum of 7j (CDCl 3, 500 MHz) Figure S35. 13 C NMR spectrum of 7j (CDCl 3, 125 MHz) Figure S36. 1 H NMR spectrum of 7k (CDCl 3, 500 MHz) Figure S37. 1 H NMR spectrum of 7l (CDCl 3, 500 MHz) Figure S38. 1 H NMR spectrum of 7m (CDCl 3, 500 MHz) Figure S39. 13 C NMR spectrum of 7m (CDCl 3, 125 MHz) Figure S40. 1 H NMR spectrum of 7n (CDCl 3, 500 MHz) Figure S41. 13 C NMR spectrum of 7n (CDCl 3, 125 MHz) Table S1. Primers used in this study S28 S29 S30 S31 S32 S33 S34 S35 S36 S37 S38 S39 S40 S41 S42 S43 S44 S45 S46 S3

Supplementary Figures Scheme S1. Synthesis of compound 7n Reagents and conditions: (a) Allyl magnesium bromide, THF, -78 ºC to room temperature; (b) MnO 2, hexane, room temperature; (c) (R)-CBS catalyst (10 mol%), BH SMe 2, DCM, 20 ºC; (d) Cl 3 C 6 H 2 COCl, DIPEA, DMAP, toluene, room temperature; (e) Grubbs 1st catalyst, CH 2 Cl 2, room temperature; (DCM = dichloromethane, DIPEA = diisopropylefhylamine, DMAP = 4-(dimethylamino) pyridine, Grubbs 1st catalyst = [(PCy 3 ) 2 Cl 2 Ru=CHPh] S4

mau 40 *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-1-1000686.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-2-1000687.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-3-1000689.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-4-1000690.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-5-1000691.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-5-2000696.D) 7c IC 50 = 0.23 ±0.04µM PNP mau 40 *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-2-2000660.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-3-2000661.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-4-2000662.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-5-2000663.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-6-1000723.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-6-3000726.D) 7d IC 50 = 0.04 ±0.01µM PNPG PNP 30 PNPG 30 20 10 0 0 µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm 0.8 µm 20 10 0 0 µm 0.025 µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm 2 4 6 8 10 min 2 4 6 8 10 min mau *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E-08-2000684.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C-5-2000696.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E-10-3000683.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E-20-3000682.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E-40-3000681.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E-80-3000680.D) 7e IC 50 = 28.66 ±3.26 µm PNPG PNP mau *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F-1-1000704.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F-2-1000705.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F-3-1000706.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F-4-1000707.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F-5-1000708.D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA7-6-3000725.D) 7f IC 50 = 0.16 ±0.03µM PNP 30 60 25 50 20 15 10 5 0 80 µm 40 µm 20 µm 10 µm 0.8 µm 10 0 µm 0.8 µm 0 40 30 20 0 µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm PNPG 2 4 6 8 10 min 0 2 4 6 8 10 Figure S1. α-glucosidase reductase inhibitory activities of 7c-7f performed by HPLC method. HPLC conditions are as follows: YMC-Pack ODS column (C18, 250 4.6 mm, 5 µm); temperature, 25 ºC; injection volume, 10 µl; flow rate, 1 ml/min; Detection wavelength: 340 nm; PNPG: p-nitrophenol glucopyranoside; PNP: p-nitrophenol. min S5

*DAD1 B, Sig=210,4 Ref=360,100 (GL\GL-1S000061.D) *DAD1 A, Sig=205,4 Ref=360,100 (GLY\PCBE 2017-03-31 08-51-45\034-0201.D) A *DAD1 B, Sig=210,4 Ref=360,100 (GL\GL-1S000066.D) *DAD1 E, Sig=210,16 Ref=360,100 (GLY\PCBE 2017-03-31 08-51-45\034-0201.D) mau Ganomycin I BmAU 7d Ganomycin I sa7 3000 1600 1400 2500 1200 2000 1000 1500 1000 0 day 800 600 400 0 day 500 0 21 days 200 0 21 days 5 10 15 20 25 30 35 min 5 10 15 20 25 30 35 min Figure S2. Comparison of the chemical stability of 7d and ganomycin I when exposed to room temperature for 3 weeks. HPLC conditions are as follows: YMC-Pack ODS column (C18, 250 4.6 mm, 5 µm); temperature, 25 ºC; concentration, 0.1 mg/ml; injection volume, 5 µl; flow rate, 1 ml/min; solvent, 60% MeCN in H 2 O (with 0.1 trifluoroacetic acid). S6

Figure S3. Long-term toxicity of 7d on C57BL/6J mice administrated with daily dose of 30.0 mg/kg for 3 months: (A) Weight change; (B) Cumulative food intake per mouse; (C) Plasma aspartate transaminase (AST); (D) Plasma alanine transaminase (ALT); (E) Free diet blood glucose; (F) Organ coefficients; (G) Macroscopic appearance of the liver. The dose of 7d treatment is 30.0 mg/kg. Measurements were taken from distinct samples. Data are presented as the mean ± SEM. N = 10 mice per group. Statistical analysis was done using two-way ANOVA followed by the Bonferroni post hoc test for A and E, and one-way ANOVA followed by the Tukey post hoc test for B-D, and F. * P<0.05; ** P<0.01; *** P<0.001. S7

Figure S4. Mean plasma concentration profile of 7d in rat plasma after intragastric administration of 7d at a dose of 2.0 mg/kg in rats. S8

A B C *** ** ** Figure S5. Effects of 7d on body weight and food intake in DIO mice: (A) Body weight gain; (B) Cumulative food intake; (C) LEE index. Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. Data are presented as the mean ± standard error of the mean (SEM). N = 8-10 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01. S9

A B 11 10 9 ### ### ### ### ### ### C D 8 7 6 * ** ** * * * ** *** ** *** *** *** 5 0 10 20 30 40 Days of treatment *** ** * E F *** *** *** *** Figure S6. Effects of 7d on blood glucose levels and insulin resistance in DIO mice: (A) Sequential monitoring of blood glucose in DIO mice after 4h fasting; (B) Free diet blood glucose in DIO mice; (C) OGTT and (D) AUC on the 25th day of treatment in DIO mice; (E) HbA1c in DIO mice; (F) ISI in DIO mice. Con, C57BL/6J mice control; Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. N = 8 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01, *** P<0.001. S10

*** *** *** *** Figure S7. Effects of 7d on lipid metabolism in DIO mice: (A) Serum TG in DIO mice; (B) Serum FFAs in DIO mice; (C) Serum TC in DIO mice. Con, C57BL/6J mice control; Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. N = 8 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01, *** P<0.001. S11

Figure S8. Effects of 7d on the in vivo α-glucosidase inhibitory activitys and small intestinal carbohydrate distribution: (A) OMTT test and (B) AUC on the 30th day of treatment in DIO mice; (C) OSTT test and (D) AUC on the 32th day of treatment in DIO mice; (E) Small intestinal carbohydrate distribution in ob/ob mice. Con, C57BL/6J mice control; Mod, DIO or ob/ob mice; Acar, Acarbose 10.0 mg/kg; Gm-I, ganomycin I 3.0 mg/kg. Values are means ±SEM (n = 8-10 for ob/ob or DIO mice); *P<0.05, **P<0.01, ***P<0.001 versus ob/ob or DIO model group. S12

Figure S9. Transcriptome analysis of the hepatic gene expression profile in 7d-treated ob/ob mice: (A) Top 10 biological processes related to inflammation and immunity of all downregulated and differentially expressed genes ( 2-fold); (B) KEGG pathway enrichment analyses of all downregulated and differentially expressed genes ( 2-fold); (C) Gene expression changes (with p < 0.05) among the 13,407 genes detected by RNA sequencing (RNA-seq; FPKM min > 0); (D) The heatmap of 46 upregulated and 284 downregulated genes that differentially expressed by two-fold or more. S13

Figure S10. Detection of pseudo-germ-free mice treated with antibiotics (Abx): (A) Cecum bloating and caecum liquid contents; (B) Colony-forming units (CFUs) in feces from each group cultivated on YCFA solid medium under anaerobic conditions. Data were obtained with three replicates. Statistical analysis was done using two-way ANOVA followed by the Bonferroni post hoc test. * P<0.05; ** P<0.01; *** P<0.001. S14

A B C D Weight gain (g) (the 20th day) ** ** ns E F G H ns I J K L M N O P * ns Figure S11. Antibiotics treatment blocks the therapeutic effects of 7d: (A) Weight gain; (B) Cumulative food intake for 18 days per mouse; (C) Free diet blood glucose; (D) HbA1c; (E) The mean AUC measured during an OGTT; (F) Insulin content; (G) Insulin sensitivity index (ISI); (H) Plasma triglycerides; (I) Plasma free fatty acids; (J) Plasma total cholesterol; (K) Plasma LDL-C; (L) Hepatic triglycerides; (M) Hepatic total cholesterol; (N) Hepatic LDL-C; (O) Hepatic free fatty acids; (P) Plasma levels of LPS. The dose of 7d treatment is 3.0 mg/kg. Data are presented as the mean ± SEM. N = 8 mice per group. Statistical analysis was done using the unpaired Student s t-test. * P<0.05; ** P<0.01; *** P<0.001. S15

Figure S12. 1 H NMR spectrum of 2b (CDCl 3, 500 MHz) S16

Figure S13. 13 C NMR spectrum of 2b (CDCl 3, 125 MHz) S17

Figure S14. 1 H NMR spectrum of 2d (CDCl 3, 500 MHz) S18

Figure S15. 13 C NMR spectrum of 2d (CDCl 3, 125 MHz) S19

Figure S16. 1 H NMR spectrum of 5 (CDCl 3, 500 MHz) S20

Figure S17. 1 H NMR spectrum of aldehyde (CDCl 3, 500 MHz) S21

Figure S18. 1 H NMR spectrum of 6 (CDCl 3, 500 MHz) S22

Figure S19. 1 H NMR spectrum of 7a (CDCl 3, 500 MHz) S23

Figure S20. 13 C NMR spectrum of 7a (CDCl 3, 125 MHz) S24

Figure S21. 1 H NMR spectrum of 7b (CDCl 3, 500 MHz) S25

Figure S22. 13 C NMR spectrum of 7b (CDCl 3, 125 MHz) S26

Figure S23. 1 H NMR spectrum of 7c (CDCl 3, 500 MHz) S27

Figure S24. 13 C NMR spectrum of 7c (CDCl 3, 125 MHz) S28

Figure S25. 1 H NMR spectrum of 7d (CDCl 3, 500 MHz) S29

Figure S26. 13 C NMR spectrum of 7d (CDCl 3, 125 MHz) S30

Figure S27. 1 H NMR spectrum of 7e (Acetone-d 6, 500 MHz) S31

Figure S28. 1 H NMR spectrum of 7f (CDCl 3, 500 MHz) S32

Figure S29. 13 C NMR spectrum of 7f (CDCl 3, 125 MHz) S33

Figure S30. 1 H NMR spectrum of 7g (CDCl 3, 500 MHz) S34

Figure S31. 13 C NMR spectrum of 7g (CDCl 3, 125 MHz) S35

Figure S32. 1 H NMR spectrum of 7h (CDCl 3, 500 MHz) S36

Figure S33. 1 H NMR spectrum of 7i (CDCl 3, 500 MHz) S37

Figure S34. 1 H NMR spectrum of 7j (CDCl 3, 500 MHz) S38

Figure S35. 13 C NMR spectrum of 7j (CDCl 3, 125 MHz) S39

Figure S36. 1 H NMR spectrum of 7k (CDCl 3, 500 MHz) S40

Figure S37. 1 H NMR spectrum of 7l (CDCl 3, 500 MHz) S41

Figure S38. 1 H NMR spectrum of 7m (CDCl 3, 500 MHz) S42

Figure S39. 13 C NMR spectrum of 7m (CDCl 3, 125 MHz) S43

Figure S40. 1 H NMR spectrum of 7n (CDCl 3, 500 MHz) S44

Figure S41. 13 C NMR spectrum of 7n (CDCl 3, 125 MHz) S45

Table S1. Primers used in this study. Name Sequence (5 3 ) Gapdh-forward Gapdh-reverse Muc1-forward Muc1-reverse Muc5-forward Muc5-reverse ZO-1-forward ZO-1-reverse Occludin-forward Occludin -reverse Pparg-forward Pparg -reverse Nos2-forward Nos2 -reverse Tnf-forward Tnf-reverse Il1a-forward Il1a-reverse AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA GGCATTCGGGCTCCTTTCTT TGGAGTGGTAGTCGATGCTAAG GTGGTTTGACACTGACTTCCC CTCCTCTCGGTGACAGAGTCT ACCCGAAACTGATGCTGTGGATAG AAATGGCCGGGCAGAACTTGTGTA TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG CCCAGGCCGGAGTTTAACC GTTGCTCATAAAGTCGGTGCT TTTTCCGAAGAACCATCCGATT ATGGCATTGTGAGACATCCCC CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG S46