( ) 2-!"#$! (!) 0! 67-./0#$ )#$ 12 3+454-*+ 4 3 2* 1.' +!* '( ) $ &!"#.' +!* '( ) $ &!"# (.' +!* '( & 0!"# ) & 0 & / (.' +!* '( & 0!"# ) & 0& ( 75,$$ / 97 #)& / 1 # / ' $& # /! 96/12/12: 96/10/20 : 7"8 98+ 8: 98+ 8:4 ;, 21,56 4 23!"#$ &'( )*+, - '#. )/01 : @58" 2-B"8.5 28:H>?8,548 @A @8" 8 8. B"CD E B$ "FG., > - =.53.B., ;J5 9+ : :4 K5 '#. )/01,H 4--/".H @8.C #83? N58'1 2O8$H ;-, )8"?4 -. E 4, J5. 20,5L: :J, H5 8 :83Q ;8 2-, 14 8. ;-.:3Q.3 7 S5'. @"., J5 ; @# O$ -Q R 3.3 ;, P.83 7" (. 2H) Y:4 2T (. 2H) U 2T H HV ),5 J5 2,H @,H.BT ),5!"H ;, @ H.3 ] U 2T ; E,H '] 5 ;E 8. Z 83 2T,H : @$O -,H 2::4- '01,H 4--/".H @5" @A + @" HH @$ > : 8: 28T 8 @$O -,H 2::4- '01,H 2-B".5 2:H>?,54 @A + @" B3 ;,H:D ""^ ;,Q _C 8: 28T,H 4--/"8.H @58" @A + @" 'D '01,H.H5+,H:D ;,Q _C >4 7`,'1 3 2T B+ 8: 28T,H 2-B"8.5 2:H>?,54 @A + @" a HO 2$ ;,H:D ""^ ;,Q _C - 3 2T B+.(P<0/05) B3H ;,H:D >4 ;,Q _C 3 2T,H ;8@A @8",H 8""^ e8]5 E 8 ). B"CD 4 HH @$ > d /P,56 :;"TU" c,548 @A @8" 8'D '801,H 8 HO @$O -,H 2::4- '01,H 2-B".5 2:H>?,54 4--/".H @5".$ 2$ ;""^?" 4--/".H @5" @A @" @?",H ":f B >4 2-B".5 2:H>?.9+ : :4 )/01 4--/".H @5" @A 2-B".5 2:H >?,54 @A. B"CD :;"'4 ;2A -1-2 -3-4 *.!#$ &'! " : javidfathi7@gmail.com:+ ")* 68
V> MHC'>2 :> >I( V 5.2 (9-11) B (8) J 7^2 I V IIx/d 7 4 :7 : 5 l(0 @4 >; >7 5> =>? >"H >"4 5"A# W?3 ; >; >7 >/# >` 5J W?3 ; 7 /( 5E(5 <i 72 $@A# V> >7 a089!# G.(12) 2 =/2 *;.( me2 23( $;/ 5 W?3 ; ">( 7( ;2 a089!# G n @>A# 7 7T; ` ; &2 >`.>( > D>"E2 >74 5 :; 5 (!0 7B2 om @A# 7 T; O>s; >;;2 p@i 7 q/ r?2 ' ' >;7:> > >7' B =2#.2 ]>> :>3 mirna mir-206 4-@>>( '>>B7 2-1>>(2 mir-1 mir-133 ;4 "&( 5"A# 7'+ 4 @A# 7T; G4 /t2 >7 V> >` c>c2 P> n<2 5 5C 2->(2 >;7:> > '.(10) >2 ] M5 5 ( @A# " ;;Os; 5 l(0 2 ' B W?3 ; $@A# -I>( >7 O>B" 5> 5>B v;;)>( >B2 >;2 =? B 5B7+ 7 5 P&" o>m W>?3 >; 7 /( 5 ` G.(13) > >&/7 $i5 ;2 PGC-1α (11) > 2! 2-(2 ;7: ' :>3 2->(2 >;7:> > ' IH.(6,14,15) PGC-1α '>'> ^>4 >" >7 2->(2 ;7: ' 4 >( P>&"/>; >7 B/; ' 5">(5 2-(2 ;7: ' (13) '.>>2 f>( V> 4-@>( 'B7 >> ')/7>> >>7=>>?2 "&>>( $@>>A#.>> =&> /B2 C D"E2 $F?3 >7:>3 5> (2 H "&( 5"A# :+ G '!> '> >2H G> 5>) 5"/C 6"E2 5> >/# >M5>7.(1) 5 I( $J O>B3 P>&"/; 7 B/; 7 >7GQ>0 '> 5"(5 7 7 2 >5E>B RS>( &>2 7O+ F?3 >7T>; @>A# 7.(2) 2 D4 '> U>( > >7'+ '>>2 5> ;>B7 6"E2 >7 5> > IIb I (MHC) IIx/d G>2 G);( 7! W?3 ; 7 I V V> 7.(3) / OB3 W?3 ; 7 7>B X> >B >Y '> ;2 )>>B* =>>32 >> >>B >>* Z>># X> P>&" >Y II V> 7 2 [!32 ;>B7 > 5;> I>( $>F?3 5 G> (4) >( G\>0 )>B* =>32 >7'+ 232 >7 >F?3 P>2 >7>] )/7 > $62 ;Q0 7^&2 ;7' @A# T G>>0 I G>>0 G>>2 >>;2 W>>?3! O( 5 ( G; CG0 5>"/C.(5) ;> 2 I( 5B7+ 7 $62 S> 5> '2 7! ` a8 =2# c>(+ =& 5 @A#-?b# 5:7 4 ;2 4 (6) 5dC eaj A# ' 8 #E f;m.(7) >/ > > >4 '>/7> > >F?3 @>A# 7 23( 4 72 ' $33< >7 >;2 7 W?3 ; 7 /( 5 >2 ` V5 IIx/IIb V W?3 ; >7 =? cc2 232 $;/ 5i.(1) 69
e>< G)>2 5>"J2 G> '0. t) >>)+.>>270±23 >>7>>2' >>( G>5> {+ 23( $;/72 (; + =>2> '>>;> + > 14 4 53H553H29) 'C zbe2 72 (; + $B"C '0. $i( ^; ';#5 ( 10) 2 5 b $i5.> O>B3(> > '>;#5 ) ( 10 5> 5>2 B 2 ( 2 72 >( 8) >( 16 5> >72 4 G; [;( '0.:7 ( (8^; : G>/ 5>2P> >"?H $>4S2 6>( > 5>2.(17,18) > >JM >7>2 > 23( 8 =2 FJ :7]0 6( 2 23( G/ > > 23>( 4 5B"C 5 >7 $> '>2.(19) > 'C zbe2 '.( '1 ^C ;/ 5B"C &'( ;E,H :!# ;H1 >.1 Y] O7 50 23 O67 45 23 O 40 20 O;0 35 20!ty 30 15!( 25 15 53H 210#( 53H5 53H 29#( 53H5! 20 10 ^ 15 10 (53H) G/ $2 ' #( (53H 2) '! ' ( g/p )L/!>"# )> Z@* 5/ r( :7]0 G 2.(LUMS.REC.1395.172) > i '( & 0 ;>B>/ 5> >72 2/ $;/ '2!>);7.> 5> a >; >;7 5>2 >;/ o> G>@ G2>?(;2 32 72 G ' '!" 7 5!"2 50 G2) ('>'!>" >7 5>!>>"25G>@ G2 *( 89 om 4-@( 'B7 >x& c>c2 >B =2# * 4 f( 5> H 4-@( 'B7.(15) 2 ^"( / 2->(2 >;7: GQ0 ' ' t2.(9) > >/7 @A#?t 5 'B7 mrna 5 mir-1 5 72 ' * 7 >;>2 >t2 '+'> > =>b24-@>(.(16) 2 @A# 7^"( / cc2 5 >"H 23>( $>;/ 5>&; G s 5>&; (8) 5> >; V> >75y 4 :7 >7 T; G4 ' v;;)( 7B2 >7' =>2# $>` *;> > ><2 :3 4-@>( 'B7 2-(2 ;7: 23>( $>;/ >8 W?3 ; ; 7 T>; >` >&2 7>( ( G&/2 e7g.( G 23( 4 8 7 23( 4 7 89 ( FJ :7]0 2->(2 >;7:> > >7' '> > >; >; V> "&( $@A# 4-@( 'B7.( B <i 72 J, H5 '> > 23>( 4 8 8 FJ :7]0 '>B7 2->(2 >;7:> > 7' 5> W>?3 >; ; "&( $@A# 4-@( >2 >( 20 >s;2 G>.> > (!>110±10) G>( 5>67 4 > >B <i.> >* '>( & 0!"# ) 2 >(() 7)>2+ c(;2 r 7'+ 2/ &> ;> > >2 zbe2 a{ f+ 5 + (>>( 5>C24±3 2 G)2 #( 12:12 8) }>"G>(5'( )2+ 'B& $i 5 '>B& ~6H572 $2 G. O7( 70
^b<2 74 84 137 =>J2!/. 6( (cdna Synthesis kit k1621. $i ( =/4( o?m ;( @A @" -, Real Time PCR)>( ' ' tc > 6>( ~&2>B2. 6( Corbett.> >2+ >t >& > 5> o"42 5"J2 G '>2 >( > =/4>( o>?m ~&2>B2 >? 5/ P e7 ~ 7' 0/4) >>> >>>/0 (>>>&2 10) ~&2>>>B2 1) cdna (>&20/4) > /0 (&2 5> >s (&28/2) ~ f+ (&2.> >?>B 6( ' >6;2 ^>; '>;#5> 5/ P("&( 36) ' '2 Run =/4>( o>?m) ~&2>B2 >+ G>4 > > '+ NTCAmplification >? Corbett >"* ^>; >7' > 5> >s (> 1 4-@('B7 (^; )?x2 ^; (Beta) P> ) '>2O>7 2->(2 >;7:>. 5( $i575/. 7 (Run 2 '2+ 5 2 * ( d 5!X. & $i 5 & >,H 2HE.H,5 ; )V($.2 Y] IC2 NCBI NM 017008.4 XM 003749164.1 NM 053449.1 5 `-3`! GATCAAGATCATTGCTCCTCCTG F BetaActin AGGGTGTAAAACGCAGCTCA R AGTGCAGGTAACACAGGTGG F MEF2 GGTTACCAGGTGAGACCAGC R AACCTAACCTGAAATTACGGTC F HADC4 ACATGCGGAGTCTGTAACATC R >7P>< 5> 7@272 5M5. R ~ ( ;7 l(0 B - RNA h(. 1000 5>> >>!>>>>"2 50-100 r>( ~ >( > 5>F '+ 5> ^> &2 300'+ >4 ' >/7 P>( >& )>( >s >2 ^>"<2 > 5>F!>">&2 l 53H15$25 ~ ( ( 0) "E2 *5 =>* s>2 ^"<2 $2 G 4 t) H('/+ *( Tlettich) 6( )( 4.(( 5C 42 12000 53H 15) 5 OB3 /BH 3 5 ^"<2 6( )( " />( 5"(5 2+5 RNA( e6 5X ^>3 >) a f&2 5 (BRAND) 5>>F '+ 5>> ^>>00 >>&2 500 >> l> 5>3H 10 $2 5 ( 0) "E2 *5 (RNA) f>&2 5 v6( f(. t) )+ B X 1000 '25 i 70 =& 5>C475005>3H 10 $>2 5> 6>( =>* 53H 10 $2 5 ~ ( H( 5> a(uv > i 75 =& =() 7 ~> f+ >X 20 17 4 5"J2. P* =* \H tc =J f&2 5 f( '2. 5 a (BiowaveII) WPA )(?>B > )>( 6>( > RNAz>"* >7?>B 5> 280nm 260nm ƒ2^m.(20) ; H1/81/6 5;2 2+ (5 CDNA?:. 5>!>H s>2 >7 RNA ƒe( 4 CDNA ;>( > > G. Revert Aid first Strand CDNA;( )>2+ >t >& > 97 / 71
'>>B7 '?>>B '>> '>>2 >>"4 5">>A# O>{"# 7 5?B G/ 4-@(.>( 5> >;42 >` 2+ < 5 :7 > '?>B '> '>2 5"A# G/7 G; /7 5?B ;/ 2-(2 ;7: '> >;42 :7> >2+ >< 5> 7>.(P<0/05) ;"TU" c "&>( 5">A# &>2 >Y G/ :> >(/7 >?t c>c2 >7>2 : >4 '> > >?t G>.> >2 2@( >4/2 >&2 RS>(.>( &2 7O+ >7;; 4/2 * 5"(5 7' G o>m II V> 4-@( 'B7 ' ;4 B $>i 2->(2 ;7: ' '"24 ' 5> >( "&> 5 ' G =24.(21) 2 ' 4 "C # 4-@( 'B7 >>'.>> >>2 2->>(2 >>;7:>> > >" >;;O>s; 2->(2 >;7: W>?3 ; $@A# ] M5 5 (1) ( @A# > ' 89> 5 5C(22) 2 ' B >Y >?t > ^>4 2->(2 >;7: '>>>>2 "&>>( $@>>A# >>B 23>>( >7/ '2 7?0 7i >) M (10) t2 "&( $@A# r?2 5 - - - ;,Q?"CQ Real Time PCR )>( >2+(5 7 >!> 5> ~ >( Os;2 Excel. ^3! 6( RG-Rest 2009 @" @?" - Rest-RG,?N - ]P )1/6.3 Y] 2:H >?,54 4--/".H @5" @A + P(H1) 0/61 0/08 0/82 @$O -,H 2::4- '01,H 2-B".5 42 S* 6/033-0/198 10/762-0/461 4/07-0/207 '2 ' 1/20 1/94 0/93 :; 0/82 0/73 0/75 ' V 54S22 ~ e7 e7 ~> ' AJ ') ;; 5"A# > 4-@>( '>B7'?>B ' '2 ' 'B7 4-@( ;7: 2-(2 Beta < 5 : O{"# 7 5B32 G/. 72 ;42 ` 2+ ->(2 ;7: '?B ' '2 ' AJ ;/ ') ;; 5"A# 2 < 5 :7 O{"# 7 5B32 ~. 72 ;42 ` 2+ @" @?" - Rest-RG,?N - ]P )1/6.4 Y] 2:H>?,54 4--/".H @5" @A + 'D '01,H 2-B".5 $@A# 7@( 'B7 Ot2 ; P PKD >7; GQ0 G E ' ( "&( 5 P(H1) 42 S* '2 ' :; ' V 54S22 ' '>B7 > =>24 5> @>A# >7>( > - 0/61 3/75-0/33 1/31 0/82 ~ 7( t;5?b 7@( q 23>( >4 5> +) P>2 ^>4!># - 0/47 3/35-0/21 0/81 0/75 e7 'B7 4-@( >7 >) > =>24 5>&" > (>72.(23) Ot( 5"A# *( B :7 0/00 1/41-0/27 0/62 0/78 e7 ;7: 2-(2 72
> ' '> :> 7>2!># O>{"# a2 23>( >4 >8 2->(2 >;7:> 23>( >;/ >{ > 5?B 72+ ;/ =&0 O7 5M5 '> > 53H 2 23 #( 53H 50 '>&/7 ˆ?;) >( $>33< > 5> >>2.(2) E/7 >< 2->(2 >;7:> ' Os; '>>B7 AMPK v;;)>>( >>B2 >>+ ^>>; G>/ 5> /s; l(0 $2 PGC-1 5-@( ` V ` " =2#.(24) ( 23( $> O 2!2 :.( OB" 'C '2 '>> ^>>4 c>>c2 ">>(' O>>B" '>>2 '>(@6B c?( GB. 2 GB 5"6>B NFAT ~ >( > NFAT B o>m >+ > >J 5>B7 =>* 5 >> ' >>* >>B >>>>(^>>4 >7 >B >{+ cc2 2-(2 ;7: '>2 >; :> 2 [(22) 2 W?3 ; NFAT > G> >B (^4 cc2 OB" c> G> >2H> > 5"6>B >J W?3 ; 7 ' 52 5B7 / $>;/ >8 O> >"*! O>B&2.22 c{ 5> > t; 5.2 Z6 V> />( 5> 7 =? 2 @A# " y G>/ >212>J q p>f5> W>?3 >; :> 5> >;2 >&& P>< >(5*y MHC-IIx :7> > '/7 5 MHC- >E/7 >FJ :7]0 75 5 (16) ( 5">A# 4-@>( 'B7' ' `!#. 5> > => G> 5 ( G&/2 :7]0 G "4 > f>b<2 "&( $@A# G; "4 5"A# '>>B7 ' '>> '>> :7]>>0 G>> >> >;/ ') ;; 5"A# 4-@( '> >& >;42 ` 7 5B32 >;; 5">A# 2-(2 ;7: ' ;/ { 5B32 ;/ ').>? >;42 >2+ >< >2 :7> O>{"# 4-@>( 'B7' ' "45"A# G; /7 >;42 >` 7> > 5>?>B ;/ >;7:> > ' '>>2 >) 7>2 7> > 5B32 ;/ 2-(2 > '. ' ;42 :7 2+ < II V> U@>4-@>( '>B7 >7GQ>0 5> >;7:> > >B > ;; 4/2) > 5>B32 (>; 5">A#) "4 5"A# (2-(2 5(19) ; I/ ;/(; 5"A#)?C Gt0 =&> 5> >. 3S2 FJ 54S2 $@>A# 2->(2 ;7: ' 4 >7 =& cc2 P ~ 72 "&( 5>(12) > >2 >7'+ 23( : W?3 ; '/7?3 (2 H 72 '>B7 >E f>( G>; [> >* # cc2( G&/2; $@A# II V U@ @( 232 C : 5 /B&2 >;7:> 4 : 5"(5 )B*.(22) 5 ^? 5 2-(2 c>>c2 >> >>4 5>> '>> $>>4S2 7 G 5 2 B 7 ` 5>? >;7>2 l>(0 23( 74 5 ibe2 :7> : 2 $` G 5 + B~0 7=4 2 5&" (2) B ' ' >7GQ>0 '>(@6B '(@6B ;2 o>3< 72+ 72 (1) C2 97 / 73
>.>2>2 H> >` '> 4 =?H ' >B7 >7GQ >0O>(@0( 5>B7 > > G> 5>C > 3S;2 t;0 5/4@( 5> l>(0 3> 7; (^4 '+ ~0.( > 5/4@( 'B7 e7 ( G&/2 5 >H > 2 7GQ0 5B7 ƒ* II '>(@6B >;42 :> 5> '> >J 23( G/ 5B"C P 4 AMPK camk '>B7 '>(@6B c>c2 ;;.72 q 5 5B7 7'+ ƒ* cc2 U@ @( >7'+ >4 $>ig (24) 2 O(@0( > ' >4 > i G; 72 :7. 2 O7 2-(2 ;7: 5> '> >FJ :7]>0 > 5>i@* M5 ' ` cc2 8 $2 5 23( 4 >;7:> > 4-@>( '>B7 >7' 2 ) ') ;; 5"A# 2-(2 :7> 2->(2 ;7: ' "4 5"A# 4-@>( '>B7' ' '2 M GQ>0 '>2:7]0 G. 72 ` >;+ $>33< 2 t;0 a >4 >( >2 >7' >B~>0 $>` ') ;; $@A# 23( 74. ( "4 H,g #$ ></<2 'H+ /;7 '0 7 $33< 2 '; /J GBJ >0 7 ' O* ( zbe"# 7.2 H &/(F 2~ 4( ' :>7 >` cc2 4-@( 'B7 ' `. 2 6;2 ^; 2-(2 ;7: -(2 ;7: ' ' 5 M'/7 >3 > '+ '> : 5 ( 7 5"/C 2 ; V 5 @A# 7 4-@( 'B7 ' /.(11) ( /7 X> >i $ >"4 5">A# 5>>+ >i 11 I V 7 i 89) W?3 ; 7 =>? >` >Y (2 s 5 ( V 7 >( O> >B >; V> >7 />( 5> 7 G >E/7 >FJ :7]>0 >75> 5 (19,23,25) RS( G ' ` (2 s 5. 5>&; >) 5>& 5> >F ~> :>0 >7:E G; /7 B~0 $@4 5 B2 > 5>C O>7 5>B7 O>(@0( ;2 "( >(5>*y 7]0 '&/7 P2.(26) '> #>( P> > VO2Peak i 75?3 '>2 >(5>*y 5>3H 60 ^>? 5> 5> '>B7 >975 4>7!>!> 8 G/?C Gt0 5"A# ' mrna U@ @( [ E/7 FJ :7]0 75 5 22 H >>2 :7> '+ 5B7 5 4 7! '2 2 =>&0 5">A# V 72+ 75/;y7.(26) >75> >2 >( $>62 >7:7]0 G ;/ 5">A# 2 :7]0 G (26) P2 :7]0 > >7>4 5> ' 5 *O7 "4 G>&/2 > >7' >* ' : 5 ;2 2 > >` '> &"/# >7'+ '> C ( '>B7 '>2 5> >) >7]0 G>; /7.; > > 5>?B 5B7 U@ @( '>>B7?>>B >>t; >>4 >> 7>>2 >7'+ GQ>0 '>2 5:7 5B7 5/4@( 74
References 1. Cohen TJ, Choi MC, Kapur M, Lira VA, Yan Z, Yao TP. HDAC4 regulates muscle fiber type-specific gene expression programs. Mol Cells. 2015; 38(4): 343-348. 2. Spangenburg EE, Booth FW. Molecular regulation of individual skeletal muscle fibre types. Acta Physiol Scand. 2003; 178(4): 413-424. 3. Schiaffino S, Reggiani C. Fiber types in mammalian skeletal muscles. Physiol Rev. 2011; 91(4): 1447-1531. 4. Claflin DR, Larkin LM, Cederna PS, Horowitz JF, Alexander NB, Cole NM, et al. Effects of high- and low-velocity resistance training on the contractile properties of skeletal muscle fibers from young and older humans. J Appl Physiol (1985). 2011; 111(4): 1021-1030. 5. Schiaffino S, Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev. 1996; 76(2): 371-423. 6. Talmadge RJ. Myosin heavy chain isoform expression following reduced neuromuscular activity: potential regulatory mechanisms. Muscle Nerve. 2000; 23(5): 661-679. 7. Pette D. The adaptive potential of skeletal muscle fibers. Can J Appl Physiol. 2002; 27(4): 423-448. 8. Bigard XA, Janmot C, Merino D, Lienhard F, Guezennec YC, D'Albis A. Endurance training affects myosin heavy chain phenotype in regenerating fast-twitch muscle. J Appl Physiol (1985). 1996; 81(6): 2658-2665. 9. Naya FJ, Olson E. MEF2: a transcriptional target for signaling pathways controlling skeletal muscle growth and differentiation. Curr Opin Cell Biol. 1999; 11(6): 683-688. 10. Potthoff MJ, Wu H, Arnold MA, Shelton JM, Backs J, McAnally J, et al. Histone deacetylase degradation and MEF2 activation promote the formation of slowtwitch myofibers. J Clin Invest. 2007; 117(9): 2459-2467. 11. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, et al. Transcriptional co-activator PGC-1 alpha drives the formation of slowtwitch muscle fibres. Nature. 2002; 418(6899): 797-801. 12. Wynne B. Encyclopedia of Global Health. American College of Sports Medicine (ACSM). SAGE Publications, Inc. 2015. 13. Wu H, Rothermel B, Kanatous S, Rosenberg P, Naya FJ, Shelton JM, et al. Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J. 2001; 20(22): 6414-6423. 14. Akimoto T, Sorg BS, Yan Z. Real-time imaging of peroxisome proliferatoractivated receptor-gamma coactivator- 1alpha promoter activity in skeletal muscles of living mice. Am J Physiol Cell Physiol. 2004; 287(3): C790-796. 15. Vega RB, Matsuda K, Oh J, Barbosa AC, Yang X, Meadows E, et al. Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell. 2004; 119(4): 555-566. 16. Backs J, Worst BC, Lehmann LH, Patrick DM, Jebessa Z, Kreusser MM, et al. Selective repression of MEF2 activity by PKA-dependent proteolysis of HDAC4. J Cell Biol. 2011; 195(3): 403-415. 17. Sturgeon KM, Ky B, Libonati JR, Schmitz KH. The effects of exercise on cardiovascular outcomes before, during, and after treatment for breast cancer. Breast Cancer Res Treat. 2014; 143(2): 219-226. 18. Sun L, Shen W, Liu Z, Guan S, Liu J, Ding S. Endurance exercise causes mitochondrial and oxidative stress in rat liver: effects of a combination of 97 / 75
mitochondrial targeting nutrients. Life Sci. 2010; 86(1): 39-44. 19. Fathi M, Gharakhanlu R. The Effect of one Session Resistance Exercise on Hdac4 gene Expression in Slow and Fast Twitch Muscles of Male Wistar Rats. Journal Ilam Univ Med Sci. 2016; 24(2): 149-157. 20. Rio DC, Ares M, Jr., Hannon GJ, Nilsen TW. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. 2010; 12(6): 39-54. 21. McGee SL. Exercise and MEF2-HDAC interactions. Appl Physiol Nutr Metab. 2007; 32(5): 852-856. 22. Harridge SD. Plasticity of human skeletal muscle: gene expression to in vivo function. Exp Physiol. 2007; 92(5): 783-797. 23. Vissing K, McGee SL, Roepstorff C, Schjerling P, Hargreaves M, Kiens B. Effect of sex differences on human MEF2 regulation during endurance exercise. Am J Physiol Endocrinol Metab. 2008; 294(2): E408-415. 24. Saleem A, Safdar A. Exercise-induced histone acetylation - playing tag with the genome. J Physiol. 2010; 588(6): 905-906. 25. Putman CT, Xu X, Gillies E, MacLean IM, Bell GJ. Effects of strength, endurance and combined training on myosin heavy chain content and fibre-type distribution in humans. Eur J Appl Physiol. 2004; 92(4): 376-384. 26. McGee SL, Fairlie E, Garnham AP, Hargreaves M. Exercise-induced histone modifications in human skeletal muscle. J Physiol. 2009; 587(24): 5951-5958. 76
The effect of endurance activity on the HDACA4 and MEF2 gene expression in skeletal muscles of male Wistar rats Bahrami F 1, Fathi M * 2, Ahmadvand H 3, Pajohi N 4 1.PhD student in physiology, Department of Physical Education and Sport Sciences, Lorestan University,khorammabad,Iran. 2. Assistant professor, Department of Physical Education and Sport Sciences, Lorestan University, khorammabad,iran, javidfathi7@gmail.com 3. Full Professor, Biochemistry, Faculty of Medical Sciences, Lorestan University of Medical Sciences, khorammabad,iran. 4. Assistant Professor, physiology, Faculty of Medical Sciences, Lorestan University of Medical Sciences, khorammabad,iran. Received: 10 Jun 2018 Accepted: 3 March 2018 Abstract Background : Skeletal muscles are composed of various contracted fibrils, which are mainly divided into fast-twitch and slow-twitch. This study aimed to investigate 8 weeks endurance activity on the MEF2 and HDACA4 gene expression in fast-twitch and slow-twitch skeletal muscles in male Wistar rats. Materials and Methods: in order to carry out this study, 20 heads of male Wistar rats, age 4 weeks (110± 10), were bought from the Razi Institute of Lorestan Medical University. The same laboratory conditions were provided for the rats for the completion of 14 days of an endurance familiarization course to teach running on treadmill. At the end of this course, the rats were randomly divided into 2 groups. Experimental group (n=10 head) and control group (n= 10 head). An eight week endurance program, 5 sessions per week, was performed for the experimental group. Results: this study showed that there was no significant change in the relative gene expression of HDACA4 and MEF2 in EDL muscle in either group (P>0.05). However, the relative gene expression of MEF2 in the experimental group was not statically significant in comparison to the control group (P>0.05). In sol muscles, there was no statically significant changes in either group s gene expression. The relative gene expression of MEF2 in the experimental group showed a statistically significant reduction in comparison to the control group (P>0.05). Conclusion: in summary, the results of this research have shown that doing 8 weeks endurance exercises did not cause any changes in HDAC4 and MEF2 gene expression in EDL muscle. Although in the SOL muscle, MEF2 gene expression decreased, no changes in the level of HDAC4 gene expression were observed. Keywords: Endurance activity, MEF2 gene, HDACA4 gene, Slow twitch and fast- twitch muscles *Citation: BahramiF, Fathi M, Ahmadvand H, Pajohi N. The effect of endurance activity on the HDACA4 and MEF2 gene expression in skeletal muscles of male Wistar rats. Yafte. 2018; 20(1):68-77. 97 / 77