(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential

Similar documents
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Supporting Information Table of Contents

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay

Supplementary material page 1/10

SUPPLEMENTARY INFORMATION

The Annexin V Apoptosis Assay

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk

Time after injection (hours) ns ns

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Effective Targeting of Quiescent Chronic Myelogenous

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1.

e-figure 1. The design of the study.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figure 1

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

RayBio KinaseSTAR TM Akt Activity Assay Kit

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

SUPPLEMENTARY INFORMATION

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Nature Medicine doi: /nm.3150

Annexin V-APC/7-AAD Apoptosis Kit

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

RayBio Annexin V-FITC Apoptosis Detection Kit

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Annexin V-PE Apoptosis Detection Kit

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

SUPPLEMENTARY INFORMATION

Paper ID: ART

Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in

Nature Immunology doi: /ni.3268

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Multi-Parameter Apoptosis Assay Kit

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

INFECTION/ INFLAMMATION

F-actin VWF Vinculin. F-actin. Vinculin VWF

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

SUPPLEMENTAL DATA. Lumen area ( m 2 )

Supplementary Figures

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Transcription:

SUPPLEMENTAL DATA Supplemental Figures Supplemental Figure 1 Supplemental Figure 1 Apoptotic events of stored platelets. (A and B) PRP was incubated at 37 under agitation for 0 (control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential ( ψ m ) depolarization and phosphatidylserine (PS) exposure by flow cytometry. Data are means ± SD from four independent experiments. *P < 0.05, **P < 0.01, compared with control by Student`s t-test. (C and D) Washed platelets (3 10 8 /ml) were incubated at 22 for indicated time. ψ m -depolarized platelets and PS-positive platelets were examined by flow cytometry. The results are from four independent experiments with different donors. *P < 0.05, **P < 0.01, ***P < 0.001 versus control by one-way ANOVA. 1

Supplemental Figure 2 Supplemental Figure 2 Apoptotic events in platelets from patients with ITP, diabetes and sepsis. PRP from patients with ITP (A and B), sepsis (C and D), and diabetes (E and F) and age- and sex-matched health controls was analyzed for ψ m depolarization and PS exposure by flow cytometry. Data are means ± SD of six patients and age- and sex-matched health controls. *P < 0.05, **P < 0.01, compared with health controls by Student`s t-test. 2

Supplemental Figure 3 Supplemental Figure 3 Plasma from patients with ITP and diabetes induces normal platelet apoptosis and reduction of PKA activity. Washed platelets (3 10 8 /ml) were incubated with plasma (1:1 volume) from patients with ITP and diabetes or age- and sex-matched health controls at 37 for 12 h. (A and D) ψ m -depolarized platelets were examined. Platelets were separated and lysed immediately. Total and phosphorylated GPIbβ was detected by western blot with anti-gpibβ and anti-pgpibβ Ser-166 antibodies. Representative western blots are shown. The blots were analyzed by Image J software. Densitometry of immunoblots for pgpibβ/gpibβ (arbitrary unit) normalized to control platelets is shown (B and E). PKA activity was examined by ELISA with PKA activity kit as described in method. PKA activity equals (sample average absorbance-blank average absorbance)/quantity of protein used per assay, normalized to control platelets (C and F). Data are means ± SD of six patients and controls. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control by Student`s t-test. 3

Supplemental Figure 4 Supplemental Figure 4 PKA activity is elevated in platelets stimulated with ristocetin. PRP was stimulated with ristocetin (1 mg/ml) or vehicle control at 37 C for 5 min in aggregometer. The stimulated platelets were lysed. The total and phosphorylated GPIbβ (A) and total PKA activity (B) were examined. Representative western blots are shown. The results were from three independent experiments with different donors. *P < 0.05, compared with control by Student`s t-test. 4

Supplemental Figure 5 Supplemental Figure 5 Bacterium induces apoptotic events in platelets. Washed platelets (1 10 7 /ml) in MTB were incubated with indicated bacteria (1:20) or vehicle control at 37 for 90 min. ψ m depolarization and PS exposure were analyzed with flow cytometry. Means ± SD of the percentage of ψ m -depolarized platelets and PS positive platelets from six independent experiments are shown. *P < 0.05, **P < 0.01, compared with control platelets by Mann-Whitney test. 5

Supplemental Figure 6 Supplemental Figure 6 PKA activator (forskolin) reduces apoptotic events in platelets stimulated by thrombin. Washed human platelets were incubated with forskolin (5 µm) or vehicle (control) at 37 for 30 min, and further incubated with indicated concentrations of thrombin or vehicle (0) at 37 for 30 min. Data are means SD of ψ m depolarization (A) and PS (B) exposure from three independent experiments. *P < 0.05, **P < 0.01, by two-way ANOVA. 6

Supplemental Figure 7 Supplemental Figure 7 Higher concentration of thrombin elevated PKA activity and activated platelets. Washed platelets were incubated with indicated concentration of thrombin or vehicle at 37 for 30 min. (A and B) Platelets were separated and lysed immediately. Total and phosphorylated GPIbβ was detected by western blot with anti-gpibβ and anti-pgpibβ Ser-166 antibodies. PKA activity was examined by ELISA with PKA activity kit as described in method. Representative immunoblots and quantification for pgpibβ (A) and PKA activity (B) are shown. Data are expressed as means SD from four independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control, by one-way ANOVA. (C and D) Platelet activation was detected by P-selectin (CD62-P) surface exposure and integrin IIb 3 activation. The treated platelets were incubated with FITC-labeled anti-cd62-p antibody or FITC-labeled PAC-1 at RT for 20 minutes in the dark and then subjected to flow cytometry analysis. Quantifications of PAC-1 (C) and CD62P (D) positive platelets were shown (mean ± SD, n = 6). ***P < 0.001 compared with control, by one-way ANOVA. 7

Supplemental Figure 8 Supplemental Figure 8 PKA inhibitor Rp-cAMPS induces platelet apoptosis. Washed human platelets (1 10 8 /ml) were treated with Rp-cAMPS (250 μm, 500 μm, 1000 μm) or vehicle at 37 C for 24 h. TMRE (100 nm) was added into the pre-treated platelets. Then samples were further incubated in the dark at 37 C for 5 min and subjected to flow cytometry. Annexin V binding buffer was mixed with the pre-incubated platelets and FITC-annexin V at a 50:10:1 ratio. Samples were gently mixed and incubated at RT for 15 min in the dark, then subjected to flow cytometry analysis. Means ± SD of the percentage of platelets with normal ψ m and PS positive platelets from four independent experiments are shown. *P < 0.05, compared with vehicle control platelets by one-way ANOVA. 8

Supplemental Figure 9 Supplemental Figure 9 H89 time-dependently induced apoptotic events in platelets. Washed platelets were incubated with H89 (37.5 µm) or vehicle control at 22 for indicated time. ψ m depolarization (JC-1) and PS exposure were detected by flow cytometry. Representative flow cytometric figures are shown (up). Means ± SD of the percentage of platelets with normal ψ m and PS positive platelets from three independent experiments are shown. *P < 0.05, **P < 0.01, compared with control by two-way ANOVA. 9

Supplemental Figure 10 Supplemental Figure 10 PKA activator forskolin reduces H89-induced apoptotic events. Washed human platelets were incubated with forskolin (10 µm) or vehicle at 22 for 10 min, and were further incubated with H89 (20 µm) or vehicle control at 22 for 320 min. ψ m depolarization (A) and PS exposure (B) were detected by flow cytometry. Means ± SD of the percentage of platelets with ψ m depolarization and PS exposure from four independent experiments are shown. *P < 0.05, compared with control by one-way ANOVA. 10

Supplemental Figure 11 Supplemental Figure 11 PCR and sequencing genotyping of mouse tail DNA. Conditional gene knockout donor DNA designed to delete the exons 6, 7 and 8 of PKA C genomic DNA by insertion of loxp sites flanking the targeted exons. The donor DNA contains a 192bp short homologous arm 5 of and a 250bp short homologous arm 3 of the floxed target exons. After Cre-treatment, the floxed exons 6, 7 and 8 was removed in vivo to result in a null allele. (A) The WT versus floxed alleles are detected using primers against the 5 loxp site and 3 loxp site, respectively. (B) 5 loxp and 3 loxp sequences are detected using primers PKA C -F and PKA C -R, respectively. The black arrows indicate WT sequence; the red arrows indicate inserted sequence. (C) The WT versus Cre alleles (450bp) are detected using primers against Cre gene. 11

Supplemental Figure 12 Supplemental Figure 12 Anti-mouse platelet antibodies (R300) incur platelet apoptosis. Washed mouse platelets were incubated with R300 (10 µg/ml) or IgG (10 µg/ml) at 37 for different time, and then analyzed for ψ m depolarization and PS exposure by flow cytometry. Means ± SD from three independent experiments are shown. **P < 0.01, compared with IgG control by two-way ANOVA. 12

Supplemental Figure 13 Supplemental Figure 13 Flow cytometric measurement for reticulated platelets. Data are means SD of 7 PKA +/+, 7 PKA +/- and 5 PKA -/- male mice. 13

Supplemental Figure 14 Supplemental Figure 14 The number and morphology of megakaryocyte in bone marrow of the PKA -/- and WT mice (n = 5). Representative images of hematoxylin and eosin-stained sections of bone marrow from WT and PKA -/- mice are shown. Megakaryocytes (MK) are indicated by black arrows. Histograph shows mean SD of the MK counts in 10 random selected fields from five separated experiments. Bars = 50 µm. 14

Supplemental Figure 15 Supplemental Figure 15 PKA inhibitor H89-induced apoptotic events are markedly decreased in Bad-deficient platelets. Washed platelets from WT and Bad -/- mice were incubated with H89 (37.5 M) or vehicle (DMSO) control at 37 for 30 min. Representative flow cytometric figures (left) and quantification (right) of ψ m depolarization (A and B) and PS externalization (C and D) are shown (mean ± SD, n = 5). *P < 0.05 compared with control, by one-way ANOVA. 15

Supplemental Figure 16 Supplemental Figure 16 The PKA -/- mice are less response to PKA inhibitor-induced platelet clearance. PKA -/- and PKA +/+ mice were injected with a single dose of Rp-cAMPS (50 mg/kg) or vehicle (PBS) control through tail vein. Platelet counts were determined at the indicated time points.*p< 0.05, **P< 0.01, ***P< 0.001, assessed by two-way ANOVA followed by Tukey s multiple comparison test (n = 5). NS, not significant. 16

Supplemental Figure 17 Supplemental Figure 17 Rp-cAMPS-induced platelet clearance in WT and Bad -/- mice. WT and Bad -/- mice were injected with a single dose of Rp-cAMPS (4 mg/kg) through tail vein. (A) Platelet counts were determined before and at 8 hours after injection. Data represent absolute platelet counts of each mouse. (B) The platelets of baseline at 8 hours after Rp-cAMPS injection. Data are means SD of 5 WT, 5 Bad -/- male mice. NS, not significant; *P < 0.05; **P < 0.01 compared with WT mice by Student s t-test. 17

Supplemental Figure 18 Supplemental Figure 18 The effects of forskolin on platelet functions. (A and B) Human washed platelets were incubated with different concentrations of forskolin or vehicle (DMSO) at 22 for 30 min. The pretreated washed platelets were stimulated with ristocetin (1.25 mg/ml) plus von Willebrand factor (7.5 g/ml) (A) and collagen (5 g/ml) (B) at 37 C under constant stirring. Platelet aggregation was recorded in a Chrono-Log aggregometer (Havertown, PA). Histograms of maximal platelet aggregation under the indicated conditions are shown as means SD of 5 independent experiments (***P < 0.001, by one-way ANOVA). 5 M forskolin did not significantly inhibit platelet aggregation induced by ristocein and collagen. (C) Washed mice platelets were incubated with H89 (25 µm), forskolin (5 µm) or vehicle (DMSO) at 22 for 30 min, and were labeled with calcein-am (5 μg/ml). The recipient mice were injected intravenously with pretreated platelets (5 10 6 /g). FeCl 3 -induced mesenteric arteriole thrombosis in the mice was recorded by real time microscopy at 12 min. There is not visible difference in the presence of labeled platelets pre-treated with different reagents in the thrombus. Each image is representative of five mice. 18

Supplemental Figure 19 Supplemental Figure 19 PKA activator protects platelets from apoptosis induced by ABT-737. (A and B) Platelets were incubated with forskolin (10 µm) or vehicle at RT for 10 min, and further incubated with different concentrations of ABT-737 at 37 for 90 min, ψ m depolarization and PS exposure in platelets were analyzed flow cytometry. (C and D) Platelets were incubated with different concentrations of forskolin at RT for 10 min, and further incubated with ABT-737 (1 µm) at 37 for 90 min, ψ m -depolarization and PS exposure are shown. *P < 0.05, **P < 0.01, compared with vehicle control, by one-way ANOVA. 19

Supplemental Figure 20 Supplemental Figure 20 PKA activator forskolin inhibits BCL-XL degredation. Washed human platelets (3 10 8 /ml) were incubated with forskolin (5 µm) or vehicle at 22 for indicated time. JC-1 was added into the platelets to a final concentration of 2 µg/ml and incubated in the dark for 10 min (A). The platelets were incubated with Lactadherin to a final concentration of 5 µg/ml in the dark for 30 min (B). The platelets were analyzed with flow cytometry. Means ± SD of the percentage of ψ m -depolarized platelets (A) and PS positive platelets (B) from three independent experiments are shown. (C) The platelets were lysed with an equal volume of lysis buffer on ice for 30 min. Proteins were separated by SDS-PAGE. After blocking, membranes were incubated with primary antibodies against BCL-XL (1:1000) and ß-actin (1:1000) at 4 C overnight. The protein bands were visualized by the ECL chemiluminescence system. The figure is representative of four separate experiments with different donors. *P < 0.05, compared with vehicle control by Student`s t-test. FSK: forskolin. 20

Supplemental Tables Supplemental Table 1: Clinical characteristics of patients with ITP Don ors Age sex Acute or chronic PLT ( 10 9 /L) Anti-Platelets antibodies Reticulated platelet (12.5±4.15%) PAIgG (35.6±7.4 %) 1 72 years old Acute 10 GPⅨ - GPⅡb - 7.7 45.8 2 28 years old Acute 20 GPⅡb - 10.5 37.1 3 60 years old Acute 15 GPⅡb - 7.7 30 4 45 years old Acute 19 2.6 28.3 GPⅢa + 5 23 years old Acute 21 4.5 52.4 GPⅢa + 6 52 years old Acute 27 10.2 37.1 GPⅢa + 7 71 years old chronic 24 8.3 46.4 GPⅢa + 21

8 67 years old Acute 18 7.2 73.1 9 45 years old chronic 31 23.5 32.9 10 30 years old Acute 13 16.8 32.9 11 32 years old chronic 13 GPⅨ - GPⅡb - 15.3 49.9 GP1b - 12 72 years old Acute 43 GPⅨ - 24.1 56 13 46 years old Acute 92 12.8 41.2 14 25 years old Acute 10 GPⅨ - GPⅡb - 5.7 35.4 15 32 years old Acute 68 GPⅨ - 10.4 50.5 16 59 years old Acute 21 GPⅨ - GPⅡb - 14.4 37.3 22

17 47 years old Acute 11 GPⅨ - GPⅡb - 6.9 54.9 18 24 years old Acute 218 6.9 50.9 19 54 years old Acute 73 GPⅨ - GPⅡb - 11.5 48.7 20 71 years old Acute Not availabl e GP1b - GPⅨ+ GPⅡb - 16.9 68.4 21 27 years old Acute 7 4.1 96 22 70 years old Acute 9 16.1 48.8 GPⅢa + GP1b - 23 69 years old Acute 17 3.1 28.2 24 51 years old Acute 2 64.8 57 25 23 years old Acute 5 0.464 35.9 GP Ⅲa - 23

Accordance with the 2012 guidelines (1), ITP is an autoimmune disease characterized by isolated thrombocytopenia (platelet count < 100 10 9 /L) due to increased platelet destruction and decreased platelet production. ITP remains a diagnosis of exclusion and presents without decrease of red and white blood cell count, normally morphological platelets on the peripheral blood smear, and normal-appearing bone marrow. 24

Supplemental Table 2: Clinical characteristics of patients with type 2 diabetes mellitus Dono rs 1 2 3 4 5 6 7 8 9 10 11 Age sex 50 years old 56 years old 54 years old 58 years old 38 years old 43 years old 45 years old 46 years old 50 years old 57 years old 66 years old Duration PLT of Other clinical ( 10 9 FPG HbAc1 / Diabetes diagnoses (mmol/l) (%) L) (years) Treatment Metformin 4 Hypertension 284 9.3 7.5 Acarbose Rui ketone 6 Cataract Insulin Upper 142 16.7 8.6 Cephalospori respiratory ns infection 4 Diabetic Nephropathy 260 6.1 6.5 Insulin Insulin 10 Hypertension 187 12.4 11.7 Amlodipine Besylate Insulin 10 Hypertension 149 4.8 6.7 Amlodipine Besylate Insulin 10 None reported 211 9.7 8.7 Exenatide Injection 8 Hypertension Insulin 155 10.6 9.0 Cataract Acarbose Insulin 11 Hypertension 194 12.9 10.3 Amlodipine Besylate Hypertension Insulin 3 Diabetic 184 6.6 6.0 Amlodipine Nephropathy Besylate Hypertension Insulin 19 Diabetic 234 6.4 6.6 Amlodipine Nephropathy Besylate Hypertension Insulin 15 Diabetic 169 5.2 5.9 Levamlodipin Nephropathy e Accordance with the 2002 guidelines (2), diabetes is diagnosed when fasting plasma glucose (FPG) is 7.0 mmol/l (126 mg/dl) or higher, and/or plasma glucose 2 h after 75 g glucose load 25

(2hPG) is 11.1 mmol/l (200 mg/dl) or higher. A casual plasma glucose (PG) > or = 11.1 mmol/l (200 mg/dl) also indicates diabetic type. Hyperglycemia is shown on two or more occasions examined on separate days. Diabetes can be diagnosed by a single PG test of Hyperglycemia if one of the following three conditions co-exists, (1) typical symptoms of diabetes mellitus; (2) HbA1c > or = 6.5% by a standardized method; or (3) unequivocal diabetic retinopathy. 26

Supplemental Table 3: Clinical characteristics of patients with Sepsis Don ors Age sex Other clinical diagnoses cultures PLT ( 10 9 /L) WBC ( 10 9 /L) Respira tory rate (breath s/min) heart rate (beats/ min) Temp eratur e ( C) 1 28 years old Trauma S.haem olyticus 176 20.6 21 134 37.2 2 82 years old Pulmonary infection, cough K.pneu moniae 148 9 25 87 38.4 3 63 years old COPD P.aerug inosa 61 14.5 16 133 37.0 16 years old 4 5 82 years old 69 years old 6 80 years old 7 Pulmonary infection, cough Pulmonary infection, Cerebral infarction Biliary tract infection Acute cholecystitis Septic shock S.haem olyticus 27 18.6 28 144 37.6 P.aerug inosa K.pneu 210 27.8 15 102 39.4 moniae E.coli Streptoc 116 20.7 22 115 39.4 occus E.coli 67 26.3 24 112 39.9 8 83 years old Multiple fractures E.coli 6 21 30 104 39.5 9 82 years old Pulmonary infection Septic shock E.coli 86 49.8 21 130 39.1 10 65 years old Pulmonary infection cough S. aureus 91 12.3 20 105 38.5 11 80 years old Intestinal obstruction B. Bacillus 125 16.1 15 109 37.4 12 72 years old Pancreatitis E.coli 109 8.9 25 96 38.5 27

13 82 years old Cholecystitis E.coli 170 13.0 28 100 39.1 14 84 years old None E. faecium 228 9.8 18 114 38.0 15 78 years old Cerebral infarction S. aureus 113 20.7 18 85 38.0 Accordance with the 2012 guidelines (3), sepsis is defined as one or more positive cultures in blood samples from patients with clinical signs of infection at least two of the following: temperature < 36 C or > 38 C, heart rate > 90 beats/minute, respiratory rate > 20 breaths/minute, PaO 2 < 4.3 kpa (32 mmhg), or white blood cell (WBC) count < 4000 or > 12,000/mm³. 28

Supplemental Table 4: Hematologic analysis of PKA +/+, PKA +/- and PKA -/- mice Hematological parameter PKA +/+ n=10 PKA +/- n=5 PKA -/- n=7 WBC(10 9 /L) 9.283±2.349 8.546±3.662 8.762±2.285 NEUT(10 9 /L) 1.795±1.648 3.548±1.657 2.527±2.115 RBC(10 9 /L) 8.937±0.744 9.290±1.097 9.560±0.589 HGB(g/L) 132.8±8.442 132.0±10.58 138.8±5.848 HCT(%) 41.17±2.074 40.93±2.650 41.94±0.782 MCV(fL) 46.21±2.209 44.96±2.302 43.98±2.245 MCH(pg) 14.90±0.542 14.46±0.513 14.52±0.376 MCHC(g/L) 322.5±5.806 322.3±5.033 330.6±9.914 RET(%) 5.007±2.005 3.403±2.377 3.764±1.262 WBC, white blood cell; NEUT, neutrophil; RBC, red blood cell; HCT, hematocrit; HGB, hemoglobin; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; MCV, mean corpuscular volume; RET, reticulocyte. Data are means ± SD. Supplemental Reference 1. Chalmers S and Tarantino MD. Romiplostim as a treatment for immune thrombocytopenia: a review. J Blood Med. 2015;6:37-44. 2. Kuzuya T, et al. Report of the Committee on the classification and diagnostic criteria of diabetes mellitus. Diabetes Res Clin Pract. 2002;55(1):65-85. 3. Dellinger RP, et al. Surviving sepsis campaign: international guidelines for management of severe sepsis and septic shock: 2012. Crit Care Med. 2013;41(2):580-637. 29