Paper ID: ART

Similar documents
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

The LaboratoryMatters

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Brief Communication Diagnostic Hematology

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital

INFECTION/ INFLAMMATION

Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

CELL-DYN 3700 Strength in Technology, Proven Reliability

Sample stability for complete blood cell count using the Sysmex XN haematological analyser

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Evaluation of haematology analyzer CELL-DYN 3700 SL

3. Blood Cell Histograms:

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

The Complete Blood Count

Kathleen Finnegan MS MT(ASCP)SHCM

Rapid Laboratories In House Tests

BASIC METABOLIC PANEL

Haematology Comparability Document

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

Incorporating Differentials Into Every Complete Blood Count. Paige Flowers, LVT Dogwood Veterinary Internal Medicine

Performance evaluation of Celltac G: a new automated hematology analyzer

Hematopathology Case Study

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

XN-SERIES. XN Technology and Case Studies

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Proper Slide Preparation

Blood Cell Identification Graded

Detection of important abnormalities of the differential

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

10/30/2015. XN Case Studies: Every Picture Tells a Story

Complete Blood Count PSI AP Biology

Differential Blood Smear H3

Icd code for cbc with differential/ platelet

COMPANY OR UNIVERSITY

Lavender Top Management SUCCESS BEYOND FINANCES

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Lavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

Influence of a light meal on routine haematological tests

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs

EDUCATIONAL COMMENTARY DIFFERENTIATING IMMATURE PERIPHERAL BLOOD CELLS

Differential Blood Smear H3

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

Research article Ερευνητικό άρθρο

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100

XN-SERIES. Hematology Case Studies: Every Picture Tells a Story

NOTE: This table will be discontinued after this lot.

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Evaluation of the Abbott CELL-DYN 4000 Hematology Analyzer

Differential Blood Smear H3

Standard Operating Procedure

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Sysmex Journal International Vol.9 No.2 (1999)

Continuing Education Questions

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD

Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential

Hematopoiesis Simplified: Part 1 Erythropoiesis

Complete Blood Count (CBC)

Blood Cell Identification Graded

e-figure 1. The design of the study.

Blood Cell Identification Graded

Clinical use of flow cytometry

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

Deconstructing the CBC

CTAD as a universal anticoagulant

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan

Clinician Blood Panel Results

Leukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University

Interpreting Blood Tests Part 1. Dr Andrew Smith

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter

3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story

Automated Hematology Analyzer. Differentiate with the XT-4000i

Laboratory Testing for the Primary Care Optometrist

MORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman

Evaluation of the Automated Haematology Analyser Sysmex NE-8000

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Clinician Blood Panel Results

Does Morphology Matter in 2017

Letter to the Editor. Effect of edta-anticoagulated whole blood storage on cell morphology examination. A need for standardization

Transcription:

analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in EDTA.Laboratory aware of the changes that occur during specific setting in order to decide whether to samples that are too old to obtain reliable r measurement of Complete blood coun differential count (DIFF) as well as periphe (PBS) morphology are essential for the corre of haematology results. Parameters useful for diagnosis and haematological disorders, such as mean cell and PBS morphology are unreliable after 12 swelling of red cells during storage at Ro affects volume-dependant variables an

count with automated differential count is s at least 24 h or even to 72 h, with signifi depending on the type of automated blood particular, the monocyte count tends to eosinophil and lymphocyte counts tend to time; neutrophil count is stable up to 72 h generation instruments. A recent study, by Daves, Zaglereta SYSMEX XN, suggested no meaningful bia after 3 h under different storage conditions blood cell distribution width (RDW) and (impedance technique, PLT-I) at 37 meaningful bias was observed for me haemoglobin (MCH) and mean corpuscular at room temperature, red blood cell (RBC corpuscular haemoglobin concentration (M MCV and PLT-I at 4 C, and RBC, RDW and PLT-I at 37 C. After 24 h, a mean

Exclusion Criteria: Blood sample collected indoor (MKCG M Blood samples received from primary health care centres. (I.e. blood samples w storage time and condition.) Blood samples received from perip verification. Procedure 88 randomly selected blood samples venepuncture and anticoagula dipotassiumethylenediamine tetra-acetic aci measured within 1 h of collection onsys (installed in the section of haematology un of Pathology, MKCG Medical College, B sample was taken as the baseline (0 h) sam measurements were made at 5, 24, and 48 baseline measurement.

showed significant decreases (P<0.05) at collection.neutrophil count was stable up increased slightly in 48h sample. The s contained too few basophils to obtain reli basophil stability. EDTA-induced changes w hours after collection, which precluded a ma count. Morphological Changes in Ps (Perephera Depending on the time the peripheral b prepared, morphological changes were seen all Cells. Some neutrophils showed nuclea changes in the chromatin, that is homogenously compared to fresh nuclei, structure of the lobes that may become cytoplasmic rim appeared ragged or less w vacuolization and loss of granules may be ob shrinkage, chromatin condensation in

collection when stored at room temperature significant decrease in WBC count was ob due to degenerative changes in cells).how changes were observed for TWBC in refri up to 48h. Platelets were only stable up to 24 hours when stored at Room temperature. Ti concentration-related changes in PLT shape spherical and swelling do occur in specim EDTA; as a result of these changes, the me (MPV) is not a fully reliable value after 24 at room temperature. Interestingly, MPV v refrigerated sample showed increased dev control value in 24h sample as compared to temp. Storage of samples at 4 C increased the s parameters. CBC parameters, namely WBC

MCV(FL) 78.22 77.77-0.5 MCH(pg.) 25.41 25.55 0.6 MCHC(g/dl) 32.42 32.89 1.5 RDW (%) 15.11 15.13 0.0 PLT(10 9 /L) 258.30 248.96-2.7 MPV(Fl) 10.42 10.65 2.2 RET% 1.24 1.25 0.8 Table 4: Mean, mean percentage change a Count on s n=88 FRESH 5 hr. Change% (<1hr) Lo NEUT 7.61 7.76 2.06 6. LYMPH 2.35 2.4 8.5 2. MONO 0.81 0.67-2.28 0. EO 0.27 0.28 8.08 0. BASO 0.046 0.048 10.28 0.

Figure 3: (variation of Haemoglobin% w storage time, in both incubated and refrige

Figure 11: (variation of Differenti Figure 12: (variation of Differential C

Figure 15: (variation of Total Eosinophi prolonged storage time, in both incubated a sample) Figure 16: (variation of Total Neutrophi prolonged storage time, in both incubated a sample)