Supplemental Information

Similar documents
SUPPLEMENTARY INFORMATION

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

Protocol for Gene Transfection & Western Blotting

Supporting Information

902 Biomed Environ Sci, 2014; 27(11):

Cornstarch

Protocol for Western Blo

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

The Schedule and the Manual of Basic Techniques for Cell Culture

Choline Assay Kit (Fluorometric)

Supplementary Figure 1

APPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation.

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figures

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis

The study on the Antioxidation of EM-X in Liver of Rat in vivo

Supplementary Information

Supplementary Information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

OxiSelect Malondialdehyde (MDA) Immunoblot Kit

Kynamro. Kynamro (mipomersen) Description

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

BCH 447. Triglyceride Determination in Serum

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Anti-obesity effects of yellow catfish protein hydrolysate on mice fed a 45% kcal high-fat diet

Supplementary Material

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Free Fatty Acid Assay Kit (Fluorometric)

The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Anti-Lamin B1/LMNB1 Picoband Antibody

2.5. AMPK activity

LNA-mediated silencing of microrna-122 in African green monkeys

Mammalian Tissue Protein Extraction Reagent

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Kynamro. Kynamro (mipomersen) Description

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a

The hepatoprotective activity of olive oil and Nigella sativa oil against CCl 4 induced hepatotoxicity in male rats

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

Juxtapid. Juxtapid (lomitapide) Description

APPENDIX 1 ETHICAL CLEARANCE

Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Amelioration of nonalcoholic fatty liver disease by hepatic stimulator substance via preservation of carnitine palmitoyl transferase-1 activity

Supplementary Information. Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a


Supplementary Material for

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Sipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the

Original Article The protective effects of Masson pine pollen aqueous extract on CCl 4. -induced oxidative damage of human hepatic cells

Supplementary Figure S1

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Protein & Enzyme Lab (BBT 314)

Activation of Chemical Biological Defense Mechanisms and Remission of Vital Oxidative Injury by Low Dose Radiation

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

Anti-obesity and fatty liver-preventing activities of Lonicera caerulea in high-fat diet-fed mice

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

BIOO RESEARCH PRODUCTS. Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:

Supporting information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Supplementary Materials for

Supplementary Materials

HT Glutathione Assay Kit

African Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp (2012)

Total Cholesterol Assay Kit (Fluorometric)

Supporting information

Low toxicity and accumulation of zinc oxide nanoparticles in mice

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Supplementary Table 1.

Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma

Total Phosphatidic Acid Assay Kit

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers

Transcription:

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total cholesterol (TC), total triglyceride (TG), aspartate aminotransferase (AST), alanine aminotransferase (ALT), high density lipoprotein (HDL) and low density lipoprotein (LDL) were obtained from Huili Biotechnology Co., Ltd. (Changchun, China). Additionally, detection kits of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), alkaline phosphatase (ALP) and malonaldehyde (MDA) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Moreover, enzyme-linked immuno sorbent assay kits of apoprotein A1 (Apo-A1), apoprotein B (Apo-B), fatty acid synthetase (FAS), tumor necrosis factor-α (TNF-α), interleukin 1 (IL- 1) and interleukin 6 (IL-6) were also purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Histopathological observation A portion of each liver tissue (cut into several portions) and abdominal fat pad were preserved into 4% paraformaldehyde solution, and then embedded in paraffin. The paraffin blocks were sliced into 4-6 μm sections, and stained with hematoxylin-eosin (H & E) for the fat pad and hepatic tissue. Sections of liver were also stained with Oil Red O before histopathological evaluation. Finally, the samples were analyzed by observing the morphological changes with an Olympus light microscope 1. Western blot analysis Liver tissue of 100 mg was homogenized in 1mL lysis buffer (200 mm of ph 6.8 Tris- HCl, 0.32 M SDS, 125 ng/ml bromophenol blue, 15.6% glycerinum, 21% Tris-Base, 6.25% β-mercaptoethanol). After 10 min, the centrifugation was performed at 15000 rad/min for 10 min and the supernatant was collected. Protein concentration of lysate was determined with a commercial kit (BestBio, Shanghai, China). Equal amounts of lysate proteins were heated at 95ºC for 5 min with one-fourth volume of 5 loading buffer. Then, electrophoresis was performed by SDS-PAGE for 30 min at 80 V in the first stage, and 60 min at 120 V in the 2nd stage, and the separated proteins was electro-blotted to

PVDF membranes. The nonspecific binding sites were blocked with 5% defatted milk in TBST (Tris 100mM, NaCl 166mM, 0.5% Tween 20) for 2h, and the transferred membrane was incubated at 4ºC for 12h with primary anti-cdp antibody (1:1000, Proteintech Group, Inc., Chicago, USA), followed by incubation at room temperature for 1h with horseradish peroxidase conjugated goat anti-rabbit secondary antibody (1:5000, Proteintech Group, Inc., Chicago, USA). The immunoreactive bands were detected using a Chemiluminescence Imaging Systems (Ultra-Violet Products, USA). References 1 D. Ren, Y. Zhao, Y. Nie, N. Yang, and X. Yang, Hypoglycemic and hepatoprotective effects of polysaccharides from Artemisia sphaerocephala Krasch seeds, Int. J. Biol. Macromol., 2014, 69, 296-306. A B Supplemental Figure 1 The partial ion chromatograms (m/z = 368) of epicatechin (IS, internal standard) and serum, urine and feces samples without IS (A). The GC-MS chromatograms of epicatechin (IS) and genistein derivatives for standard compounds, and serum, urine and feces samples of HF-fed mice (B). Although epicatechin was found in many food, its typical ion peak (m/z = 368) was no found in serum, urine and feces samples in this study (Supplemental Figure 1A). Thus, epicatechin as internal standard was applied for determination of genistein in serum, urine

and feces samples in current research. Supplemental Figure 2 GC MS chromatograms of EFA and FFA obtained from mice serum and standard substance (St.) at selected ion monitoring (SIM) model. Peaks: (1) C8:0, (2) C10:0, (3) C11:0, (4) C12:0, (5) C13:0, (6) C14:1, (7) C14:0, (8) C15:1, (9) C15:0, (10) C16:1, (11) C16:0, (12) C17:1, (13) C17:0, (14) γ-c18:3, (15) C18:2, (16) C18:1, (17) C18:1t, (18) C18:0, (19) C20:4, (20) C20:5, (21) C20:3, (22) C20:2, (23) C18:3, (24) C20:0, (25) C21:0, (26) C22:6, (27) C22:2, (28) C22:1, (29) C22:0, (30) C23:0, (31) C24:1, (32) C24:0.

Supplemental Figure 3 GC MS chromatograms of EFA and FFA obtained from mice liver and standard substance (St.) at selected ion monitoring (SIM) model. Peaks: (1) C8:0, (2) C10:0, (3) C11:0, (4) C12:0, (5) C13:0, (6) C14:1, (7) C14:0, (8) C15:1, (9) C15:0, (10) C16:1, (11) C16:0, (12) C17:1, (13) C17:0, (14) γ-c18:3, (15) C18:2, (16) C18:1, (17) C18:1t, (18) C18:0, (19) C20:4, (20) C20:5, (21) C20:3, (22) C20:2, (23) C18:3, (24) C20:0, (25) C21:0, (26) C22:6, (27) C22:2, (28) C22:1, (29) C22:0, (30) C23:0, (31) C24:1, (32) C24:0.

Serum EFA Serum FFA Liver EFA Liver FFA Supplemental Figure 4 Column plots of VIP value with jack-knifed confidence intervals for multivariate statistical analysis of serum fatty acid.

A B C D Supplemental Figure 5 Z-score plots of serum EFA (A) and FFA (B), and hepatic EFA (C) and FFA (D), respectively. The blue *, ** and *** means the statistical significance (p < 0.05, 0.01 and 0.001, respectively) between the normal group and model group by Wilcoxon Mann-Whitney Test. A B Supplemental Figure 6 Potential biomarkers about fatty acid metabolism in HF-diet fed mice: C20:4 (A) and C22:6 (B) in FFA of mice liver. a,b Values having different superscripts are significantly different (p < 0.05).