THURSDAY, JANUARY

Similar documents
Laminopathies: many diseases, one gene. Report of the first Italian Meeting Course on Laminopathies

Nuclear Envelope and Muscular Dystrophy

Neuromuscular Disorders 13 (2003) Workshop report

HYBRID GENE THERAPY FOR AD-EDMD

L aminopathies represent a heterogeneous group of genetic

Anesthesia recommendations for patients suffering from Emery-Dreifuss Muscular Dystrophy

Risk prediction in inherited conditions Laminopathies

Workshop report. 1. Introduction

Novel LMNA Mutation in a Taiwanese Family with Autosomal Dominant Emery-Dreifuss Muscular Dystrophy

Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling

2015 PhD proposal. CIFRE Grant SANOFI Centre de Recherche en Myologie Altered calcium homeostasis and LMNA-cardiomyopathy

MODIFIED FINAL ACTIVITY REPORT

Genotype phenotype correlations in laminopathies: how does fate translate?

Clinical Cell Biology Organelles in Health and Disease

Sagittal balance MASTER COURSE. COPENHAGEN- HOTEL KONG ARTHUR Friday April 27th, 2012

Gene therapy and genome editing technologies for the study and potential treatment of :

When Lamins Go Bad: Nuclear Structure and Disease

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

Prelamin A-mediated nuclear envelope dynamics in normal and laminopathic cells

Importance of molecular cell biology investigations in human medicine in the story of the Hutchinson-Gilford progeria syndrome

Laminopathies: A consequence of mechanical stress or gene expression disturbances?

HUTCHINSON-GILFORD progeria syndrome (HGPS)

Laminopathies and the long strange trip from basic cell biology to therapy

The laminopathies: a clinical review

Non-commercial use only

Keywords: BAF, BANF1, prelamin A, lamin A/C, laminopathies, emerin, EDMD1. Introduction

Downloaded on T20:37:32Z

The Genes, Proteins, and the Cell Biological Processes Underlying Emery-Dreifuss Muscular Dystrophy

Reviews. Mechanisms Underlying Caloric Restriction, Lipid Metabolism, and Life Span Regulation Issei Komuro, Guest Editor

Lipodystrophy-Linked LMNA p.r482w Mutation Induces Clinical Early Atherosclerosis and In Vitro Endothelial Dysfunction

Familial DilatedCardiomyopathy Georgios K Efthimiadis, MD

The Nuclear Envelope as a Signaling Node in Development and Disease

ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt

Eiger BioPharmaceuticals Reports on 2018 R&D Day

Rescue of heterochromatin organization in Hutchinson- Gilford progeria by drug treatment

Lamins, laminopathies and disease mechanisms: Possible role for proteasomal degradation of key regulatory proteins

YES NO UNKNOWN. Stage I: Rule-Out Dashboard Secondary Findings in Adults ACTIONABILITY PENETRANCE SIGNIFICANCE/BURDEN OF DISEASE NEXT STEPS

Contribution of genetics for sudden death risk stratification in dilated cardiomyopathy

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

Cerebral Small Vessel Disease and HAND in ARV-treated Subjects

Specific phosphorylation of Ser458 of A-type lamins in LMNA-associated myopathy patients

Nuclear envelopathies: a complex LINC between nuclear envelope and pathology

RESTORATION OF VISION

In silico analysis of Progeria: A genetic disease and natural cardiovascular disorders preventive compounds

Statutory Approvals Committee minutes

Open PHACTS Computational Protocols for in silico Target Validation of Cellular Phenotypic Screens: Knowing the Knowns

Thursday, September 20 Registration and Poster Set-up

Available online at

Cardiac follow-up in patients with hereditary muscular diseases

Nuclear lamins, diseases and aging Anna Mattout 1, Thomas Dechat 2, Stephen A Adam 2, Robert D Goldman 2 and Yosef Gruenbaum 1

MG132-induced progerin clearance is mediated by autophagy activation and splicing regulation

Skeletal myopathy in a family with lamin A/C cardiac disease

Proteins that bind A-type lamins: integrating isolated clues

Novel LMNA mutations in patients with Emery-Dreifuss muscular dystrophy and functional characterization of four LMNA mutations

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

4 Global CARDIOVASCULAR EDUCATIONAL FORUM. Russia. Russian Cardiovascular Days ST PETERSBURG. cardiovascular-forum.com

Antagonistic functions of LMNA isoforms in energy expenditure and lifespan

Early-Onset LMNA-Associated Muscular Dystrophy with Later Involvement of Contracture

DEVELOPMENT OF A MOUSE MODEL FOR HUTCHINSON-GILFORD PROGERIA SYNDROME REVEAL DEFECTS IN ADULT STEM CELL MAINTENANCE

Thursday, September 20 Registration and Poster Set-up

Clinical Relevance of Atrial Fibrillation/Flutter, Stroke, Pacemaker Implant, and Heart Failure in Emery-Dreifuss Muscular Dystrophy

8 th EuroCMR Meeting - Florence 2010 Start: Thursday, End: Saturday (+ CMR exam)

Lipodystrophic laminopathies: Diagnostic clues

One-year metreleptin improves insulin secretion in patients with diabetes linked to genetic lipodystrophic syndromes

Expression of a Mutant Lamin A That Causes Emery-Dreifuss Muscular Dystrophy Inhibits In Vitro Differentiation of C2C12 Myoblasts

NETHERLANDS. Movement Disorders in Children and Adolescents MDS Course Program

Hutchinson-Gilford Progeria Syndrome and its Relevance to Cardiovascular Diseases and Normal Aging

Towards a New Era in Dermocosmetics

Inherited Arrhythmia Syndromes

Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome

IN the spring of 2007, a 2-year clinical drug trial began at

We are most delighted to welcome you in Paris.

SCIENTIFIC ORGANISATION

PRELIMINARY PROGRAMME

All-trans retinoic acid and rapamycin normalize Hutchinson Gilford progeria fibroblast phenotype

Polycystic ovary syndrome (PCOS) is the most

Preliminary programme. Masterclass. Mobidays. Skills Enhancement - Spine. Strasbourg, France December Institute


Version 1.11 of 20/07/2018

Inflammatory myopathy in the context of an unusual overlapping laminopathy

Durham E-Theses. The Application of a Statistical Model Investigating Reactive Oxygen Species in Premature Ageing Syndromes MUTER, JOANNE,RUTH

Partial lipodystrophy with severe insulin resistance and adult progeria Werner syndrome

LMNA cardiomyopathy: cell biology and genetics meet clinical medicine

T he LMNA gene encodes two nuclear envelope proteins,

DISCLOSURE STATEMENT

08:45-09:00 Dr. Eiman Mustafawi Dean, College of Arts and Sciences, Qatar University

PROVISIONAL PROGRAM ELECTROMAGNETIC, ACOUSTIC THEORY AND MODELLING

Mandibuloacral Dysplasia Is Caused by a Mutation in LMNA-Encoding Lamin A/C

Requirements for Efficient Proteolytic Cleavage of Prelamin A by ZMPSTE24

DFG. DFG Hinterzartener Kreis für Krebsforschung. From Molecular Mechanisms to Cancer Therapy. May 15-18, 2014 Villa La Collina Cadenabbia (Co), Italy

THE JOURNAL OF CELL BIOLOGY

European. on congenital heart disease. bordeaux November 16 th -19 th, 2016

Title:A novel lamin A/C gene mutation causing spinal muscular atrophy-like phenotype with arrhythmia and cardiac hypofunction: report of one case

Infos:

Emery-Dreifuss muscular dystrophy: the most recognizable laminopathy

Long-Term Post Transplantation Care. Pathogenesis and Management of Long Term Cardiovascular and Metabolic Complications in Renal Transplantation

Progeria, the nucleolus and farnesyltransferase inhibitors

Novel Roles for A-Type Lamins in Maintaining Genomic Stability

1 st course Genome Instability & Human Disease - May

Masterclass. Mobidays. Skills Enhancement - Spine. Strasbourg, France April Institute

Transcription:

THURSDAY, JANUARY 15 2015 08.30-09.00 WELCOME COFFEE 09.00-09.15 Welcome and opening comments. A. De Sandre-Giovannoli, N. Lévy Presentation of the French Network on EDMD and other nucleopathies. G. Bonne, R. Ben Yaou Presentation of the Italian Network on laminopathies. G. Lattanzi 09.15-15.45 SESSION 1: PRECLINICAL RESEARCH ON LAMINOPATHIES 09.15-09.45 Mechanisms involved in natural and pathological aging, an overview. C. Lopez-Otín 1.1 - IPS CELLS AND OTHER IN VITRO MODELS OF LAMINOPATHIES 09.45-10.00 High-throughput screening of drugs using HGPS-iPS cells. X. Nissan 10.00-10.15 Development of a SMCs model from HGPS-iPS and proofs of principle. L. Ferreira 10.15-10.30 Human induced pluripotent stem cells to model genetic lipodystrophies: LMNA p.r482w mutation alters adipocyte and endothelial cell differentiation. N. Briand 10.30-10.45 3D culture system of muscle precursor cell to reveal mechanosensing defects in nuclear envelope related disorders. C. Coirault 10.45-11.00 Prelamin A accumulation in endothelial cells induces premature senescence and functional impairment. C. Badens 11.00-11.30 COFFEE BREAK AND VISIT OF THE EXHIBITION 1.2 - IN VIVO MODELS OF LAMINOPATHIES 11.30-11.45 Hypothalamic involvement in premature aging laminopathies. C. Cavadas 11.45-12.00 Investigation of pathomechanisms of ventricular arrhythmias in cardiac laminopathies. A. Muchir 1.3 - NOVEL THERAPEUTIC APPROACHES / PROOFS OF PRINCIPLE IN LAMINOPATHIES 12.00-12.15 New therapeutic approaches to HGPS based on progerin inhibition. C. Pellegrini 12.15-12.30 Compound X preclinical study in HGPS. K. Harhouri 12.30-12.45 Impairment of LaminA/C-Polycomb crosstalk as a possible epigenetic cause of Emery Dreifuss Muscular Dystrophy (EDMD). C. Lanzuolo 12.45-13.00 Gene therapy approaches for striated muscle laminopathies. F. Azibani

THURSDAY, JANUARY 15 13.00-14.00 LUNCH BREAK AND VISIT OF THE EXHIBITION 14.00-14.15 Metreleptin in lipodystrophic laminopathies - effects on insulin secretion. C. Vatier 14.15-14.30 Vascular consequences of farnesylated prelamin A accumulation: role of LMNA mutations and antihiv - protease inhibitor treatment. C. Vigouroux 1.4 - NOVEL BIOMARKERS IN LAMINOPATHIES 14.30-15.00 Chromatin dynamics and in vitro biomarkers in laminopathies, an overview. G. Lattanzi 15.00-15.15 LMNA p.r482w mutation related to FPLD2 alters SREBP1-LMNA interactions in human fibroblasts and adipose stem cells. B. Buendia 15.15-15.30 Altered cytokine profiles in laminopathic patients. P. Bernasconi 15.30-15.45 Micro-RNAs deregulation in Hutchinson-Gilford Progeria. P. Roll 15.45-19.30 SESSION 2: CLINICAL RESEARCH 2.1 - CASE REPORTS / NOVEL MUTATIONS AND PHENOTYPES / OTHER NUCLEAR ENVELOPATHIES 15.45-16.00 Update of Emerinopathies clinical genetic spectrum. F. Leturcq 16.00-16.15 FHL1 isoforms and X-linked Emery-Dreifuss muscle Dystrophy. E. Ziat 16.15-16.30 LMNA-associated myopathies: The Italian experience in a large cohort of patients. L. Maggi 16.30-16.45 Transportin 3 defects in LGMD1F. S. Ortolano 16.45-17.00 Emerin oligomerisation properties, impact on lamin and actin recognition. I. Herraa 17.00-17.15 Irisin assessment in lipodystrophic laminopathies. M.C. Vantyghem 17.15-17.30 Lamins involvement in spermatogenesis. M. Mitchell, C. Guillemain 17.30-18.00 COFFEE BREAK AND VISIT OF THE EXHIBITION 2.2 CLINICAL TRIAL DESIGN FOR RARE DISEASES 18.00-18.30 Which support from the French Rare Disease Foundation towards clinical trials set up in rare diseases. L. Ravagnan 18.30-19.00 Systemic antisense morpholino approaches in genetic diseases. R. Kole (Sarepta Therapeutics) 19.00-19.30 Round table: potential collaborations and future prospects chairs: G. Lattanzi, G. Bonne 19.30-19.35 Closure of the first day A. De Sandre-Giovannoli, N. Lévy

FRIDAY, JANUARY 16 2015 08.30-09.00 WELCOME COFFEE 09.00-09.15 Welcome and opening comments A. De Sandre-Giovannoli, N. Lévy 09.15-09.45 Laminopathies : clinical presentations and management - a multifaceted approach. R. Hennekam 09.45-12.00 SESSION 1 : ADVANCES IN THERAPEUTIC APPROACHES FOR LAMINOPATHIES 09.45-10.15 Congenital muscular dystrophies linked to the LMNA gene and their early management. S. Quijano-Roy, A. D Amico 10.15-10.45 Implantable devices and cardiac management in striated muscle laminopathies and utility of the molecular genetics diagnosis in the clinical management. K. Wahbi, G. Boriani 10.45-11.00 Advances in muscle imaging for Emery-Dreifuss Muscular Dystrophy. N. Carboni 11.00-11.30 COFFEE BREAK AND VISIT OF THE EXHIBITION 11.30-12.00 Results of the leptin-based clinical trials in LMNA-linked lipodystrophies. C. Vigouroux 12.00-13.30 LUNCH BREAK AND VISIT OF THE EXHIBITION 13.30-14.00 Update on the morpholino trial preparation for HGPS & HGPS-like patients. A. De Sandre-Giovannoli 14.00-15.00 Round table : discussions with families and associations chairs: A. Gambineri, T. Mongini 15.00-17.30 SESSION 2: FOCUS ON REGISTRIES AND DATABASES 15.00-15.30 Utility of patients registries to gather clinical, epidemiological and molecular informations. C. Béroud 15.30-16.15 COFFEE BREAK AND VISIT OF THE EXHIBITION 16.15-16.30 Clinical aspects of cardiolaminopathies and prospects for a cardiolaminopathy registry. L. Politano, S. Benedetti. 16.30-17.00 A common French-Italian laminopathies registry - update and future prospects. G. Bonne 17.00-17.20 ECLip- the European consortium on lipodystrophies: an update. D. Araujo-Vilar 17.20-17.30 Conclusions and closure A. De Sandre-Giovannoli, N. Lévy

NOTES

ORGANISATION : Dr. Annachiara De Sandre-Giovannoli, Pr. Catherine Badens & Pr. Nicolas Lévy Laboratoire de Génétique Moléculaire Département de Génétique Médicale Hôpital d'enfants La Timone - Marseille Dr. Gisèle Bonne, Dr. France Leturcq & Dr. Rabah Ben Yaou Center of Research in Myology UPMC - Inserm UMRS 974, CNRS FRE3617 Institut de Myologie - G.H. Pitie-Salpetriere - Paris Dr. Giovanna Lattanzi Istituto di Genetica Molecolare - Sede di Bologna Istituto Ortopedico Rizzoli - Bologna GENERAL ORGANISATION MCO CONGRÈS 27, rue du four à chaux, 13007 Marseille, France tel.: +33(0)495093800 - fax.: +33(0)495093801 www.mcocongres.com information, registration... audrey.martin@mcocongres.com contact industry natalie.ruxton@mcocongres.com