Supplemental Table S1

Similar documents
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

Supplementary Figures

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figures

Supplementary Material

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

Supplementary Figures

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

T H E J O U R N A L O F C E L L B I O L O G Y

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplementary Figures

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

Supplementary Information and Figure legends

Supplementary Information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

SUPPLEMENTARY INFORMATION

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

SUPPLEMENTARY INFORMATION

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplemental Figure 1

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Supplementary methods:

Supplementary Figure 1

Supplemental Figure 1

Supplementary Information Titles Journal: Nature Medicine

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

SUPPLEMENTARY INFORMATION

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Supplemental Figures Supplemental Figure 1:

Supplementary Figure 1 IL-27 IL

SUPPLEMENTARY INFORMATION

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer

Nature Biotechnology: doi: /nbt Supplementary Figure 1

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Tbk1-TKO! DN cells (%)! 15! 10!

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Tissue Factor/PAR2 signaling enhances the malignancy and radiation resistance of lung cancer brain metastases

Supplementary Figure 1

Supplemental Figure 1

supplementary information

MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer

Expanded View Figures

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Nature Medicine doi: /nm.3957

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Supplemental Figures:

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Materials for

SUPPLEMENTARY LEGENDS...

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

Metastasis regulation by PPARD expression in cancer cells

Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer

Supplementary Figure 1

Transcription:

Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected subcutaneously with, tumor cells and sacrificed after 6 weeks b number of mice with palpable tumors at injection site relative to total number of mice injected c bi-dimensional measurements d number of mice with visible lung metastases at time of necropsy relative to the total number of mice bearing visible subcutaneous tumors Supplemental Table S

Supplemental Table S. Effect of Jagged and Jagged knockdown on 44SQ and 44P tumor growth and metastasis a Cell Lines Tumorigenicity b Lung Metastasis c 44SQ-scr for Jag 8/8 8/8 44SQ-Jag shrna 6/8 p =. d /6 p =.55 44SQ-scr Jag 5/5 4/5 44SQ-Jag shrna /5 p =. / p <. 44P-scr 8/ 5/8 44P-Jag shrna 9/ p = /9 p =.4 a Mice were injected subcutaneously with the indicated tumor cells and sacrificed after 6 weeks. b number of mice with palpable tumors at injection site relative to total number of mice injected. c number of mice with visible lung metastases at time of necropsy relative to the total number of mice bearing visible subcutaneous tumors d incidence in controls versus Jagged shrna transfectants (One-sided Fisher exact test) Supplemental Table S

Supplemental Table S. Effect of Gata knockdown on 44SQ and 44P tumor growth and metastasis a Cell Lines Tumorigenicity b Lung Metastasis c 44SQ-scr 5/5 5/5 44SQ-Gata shrna 5/5 p =. d /5 p =.4 44P-scr 8/ 5/8 44P-Gata shrna 9/ p = /9 p =.4 a Mice were injected subcutaneously with the indicated tumor cells and sacrificed after 6 weeks b number of mice with palpable tumors at injection site relative to total number of mice injected c number of mice with visible lung metastases at time of necropsy relative to the total number of mice bearing visible subcutaneous tumors d incidence in controls versus Gata shrna transfectants (One sided Fisher exact test) Supplemental Table S

Supplemental Table S4. Correlation of GATA with EMT in CD high and CD low human lung adenocarcinomas a CDH c VIM c ZEB c N d R e P e R P R P b CD high 96 -..4.6 <..46 <. Chitale dataset b CD low 97 -.9.4..74..5 Tomida dataset CD high 58 -...4... CD low 59 -.4.6.6..7 a Human lung adenocarcinomas from two independent patient cohorts (Chitale et al., 9, and Tomida et al., 9) b CD high or CD low defined on the basis of PROM expression above or below the median value, respectively c GATA was correlated with CDH, VIM, or ZEB by performing two sided Spearman's rank correlation coefficient analysis d Cohort sample size e Spearman s R and P values Supplemental Table S4

A B % CD staining Cells p=.9 9P 44SQ CD.7% Supplemental Figure S. CD expression in murine lung adenocarcinoma cells. (A) CD is expressed more frequently in metastasis-prone 44SQ than it is in non-metastatic 9P lung adenocarcinoma cells. CD expression was detected in monolayer cultures by anti-cd immunofluorescent staining. Positive cells were counted and expressed as the number of positive cells per high powered field. (B) Flow cytometry to isolate CD high and CD low cell fractions. CD high fraction (P8) isolated from 44SQ subcutaneous tumors. Percentages of total cells subjected to flow sorting that were CD high are indicated (upper left corner of box).

CD Jag CD / Jag CD / Jag / DAPI Supplemental Figure S. CD high 44SQ cells are heterogeneous in Notch ligand expression. Illustrated are CD-expressing tumor cells that either do (middle row) or do not (bottom row) co-express Jagged. Immunofluorescent staining of a subcutaneous 44SQ tumor to detect Jagged (red) and CD (green), which were merged. Sections were co-stained with DAPI (blue). Scale bar in lower left corner of each panel indicates μm. Top row (4x), middle and bottom rows (x).

A Scr Gata KD p=.6 p<. p=.4 p<. p=5.5 5 4.6.4..8.6.4...8.6.4. Gata Gata Gata4 Gata5 Gata6 B Vec Gata cdna p<. p<. p<. p=.44 p<..8.6.4. 6.5.5 5 4 Gata Gata Gata Gata4 Gata5 Supplemental Figure S. Gata regulates the expression of Gata, Gata, and Gata5. Quantitative RT-PCR was performed to determine the relative mrna levels of other Gata family members in (A) 44SQ cells stably transfected with control shrna (Scr) or Gata shrna (Gata KD) and (B) Gata KD cells stably transfected with vectors that are empty (vec) or express Gata cdna. Note that the expression of Gata, Gata, and Gata5 is suppressed by Gata knockdown and restored in Gata KD cells by forced Gata expression. Values represent means (±S.D.) of replicate (triplicate) samples.

A Vector Jag KD p<. p<. p<. p<. p<. p<..9.8.7.6.4....6.4..8.6.4.....5...5.5..5..5....5 Jag Gata mir-a mir-b mir-c mir-49 B Vector Gata KD p<. p<. p<. p<. p<..6.4..8.6.4....5...5.5..5..5....5 Gata mir-a mir-b mir-c mir-49 Supplemental Figure S4. Jag and Gata suppress expression of mir- family in 44P lung adenocarcinoma cells. Gene expression was analyzed in 44P cells stably transfected with shrnas against Jagged (A) or Gata (B). Values represent means (±S.D.) of replicate (triplicate) samples.

Scr JAG KD p <. p =. p =. p =. p =.7 p <..5.5.6.4... 5 5 5 5 9 8 7 6 5 4 4 8 6 4 7 6 5 4 JAG GATA mir-4 mir-a mir-b mir-c Supplemental Figure S5. Jagged increases GATA and suppresses mir- in a human lung cancer cell line. HCC5 cells were transiently transfected with control (scr) or Jagged (JAG KD) shrnas. Quantitative RT-PCR was performed to determine the relative expression of Jagged, GATA, and mir- family members. Values represent means (±S.D.) of replicate (triplicate) samples.

Supplemental Figure S6. mir- suppression by Gata requires the putative Gata binding site. Reporter assays performed on MCF-7 cells co-transfected with Gata (black bars) or control (white bars) expression vectors and pgl-based reporters containing nothing (pgl), wild-type mir-b promoter sequences from - to +9 (), the promoter fragment containing mutations in the E boxes (E-box mut) from - to -5 (CACCTG to CACCGG for each E-box), or the promoter fragment containing mutations in the putative Gata binding site (Gata mut) from -79 to -7 (GAGATTGGC to GACCTTGGC). Values were normalized based on renilla luciferase and expressed as the means (±S.D.) of replicate (triplicate) wells relative to cells co-transfected with empty vector, which were set at..

A B Wild type GFP + 44SQ-GFP % GFP +.% C.8.7.6.4....5.5 CD low CD high GFP + Jag Gata Supplemental Figure S7. Jagged and Gata are co-expressed in early metastases. (A) Gata detected in metastases but not primary lung tumors in Kras LA/+ ; p5 R7HΔG/+ mice. Gata immunofluorescent staining (top panels) of a primary lung tumor (left), cardiac metastasis (middle), and hepatic metastasis (right). Gata-positive cells are green. Adjacent tissues sections stained with hematoxylin and eosin (bottom panels). Bars: μm. (B) Syngeneic mice were subcutaneously injected with or without (wild type) GFP-expressing 44SQ cells (44SQ-GFP) for weeks, and tumor cells of early lung metastases were analyzed and collected by flow cytometric sorting for GFP + cells from mouse lungs, which represents.% of total lung cells. (C) Quantitative PCR were performed to determine the relative expression of Jagged and Gata in CD low, CD high, and GFP + early metastatic 44SQ cells from (B).