AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY

Similar documents
Effects of sitagliptin on cardiac metabolism in mice

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Extensive impact of saturated fatty acids on metabolic and cardiovascular profile in rats with diet-induced obesity: a canonical analysis

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

Angiotensin-Converting Enzyme-2 Overexpression Improves Left Ventricular Remodeling and Function in a Rat Model of Diabetic Cardiomyopathy

Blockade of Renin-Angiotensin System Attenuates Cardiac Remodeling in Rats Undergoing Aortic Stenosis

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

CNS Effects of Aldosterone :

Supplementary Materials for

Cardiovascular Protection and the RAS

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL. REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY.

Age-related changes in cardiovascular system. Dr. Rehab Gwada

Prevention of Atrial Fibrillation and Heart Failure in the Hypertensive Patient

There is no conflict of interests for the following presentation

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

Ventricular Interactions in the Normal and Failing Heart

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Pathophysiology of heart failure with preserved ejection fraction. Extracellular matrix

Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Heart Failure with Preserved Ejection Fraction: Mechanisms and Management

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Recovery of Myocardial Infarction via Unique Modulation of the Cardiac Microenvironment

Chem Lecture 10 Signal Transduction

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

Estrogens vs Testosterone for cardiovascular health and longevity

PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses

Cardiac AT 1 Receptor-Dependent and IGF1 Receptor-Independent Signaling Is Activated by a Single Bout of Resistance Exercise

Myocardial Remodeling in Chronic Pressure or Volume Overload in the Rat Heart

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Risk Stratification in Heart Failure: The Role of Emerging Biomarkers

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

C57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment

Hypoinsulinemia is strongly associated with coronary artery calcification (CAC) assessed by multislice computed tomography

Preserved EF with heart failure (HF pef) 50% 5 year survival. Both have type 2 diabetes Both have hypertension Both have normal ejection fractions

MOLECULAR MECHANISMS INVOLVED IN ANGIOTENSIN-(1-7)/Mas. Short title: Ang-(1-7)/Mas signaling pathway in cardiomyocytes

The Diabetes Link to Heart Disease

Introduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Cedars Sinai Diabetes. Michael A. Weber

SUPPLEMENTAL DATA. Lumen area ( m 2 )

New Trials. Iain Squire. Professor of Cardiovascular Medicine University of Leicester. Chair, BSH

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Histomorphometric Evaluation of the Small Coronary Arteries in Rats Exposed to Industrial Noise

Effect of chronic oral administration of a low dose of captopril on sodium appetite of hypothyroid rats. Influence of aldosterone treatment

Diabetes and the Heart

Severe Left Ventricular Dysfunction: Evolving Revascularization Strategies

Blood Pressure Goal in Elderly Hypertensive Patients with Diabetes Mellitus: A Subanalysis of the CASE-J Trial

Diastolic Heart Failure

Heart Failure: The Frequent, Forgotten and often Fatal Complication of Type 2 Diabetes

The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease

Diastolic Heart Failure. Edwin Tulloch-Reid MBBS FACC Consultant Cardiologist Heart Institute of the Caribbean December 2012

ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary

Value of cardiac rehabilitation Prof. Dr. L Vanhees

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Paul M McKie, Alessandro Cataliotti, Guido Boerrigter, Horng C Chen, Fernando L Martin, and John C Burnett Jr

Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication

Regression of Electrocardiographic Left Ventricular Hypertrophy by Losartan Versus Atenolol

Oxidative Stress Unify the Pathophysiological Mechanism of Experimental Hypertension and Diabetes of Spontaneously Hypertensive Stroke-Prone Rats

Vascular Alterations in High-fat Diet-obese Rats: Role of Endothelial L-arginine/NO Pathway

LXIV: DRUGS: 4. RAS BLOCKADE

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Hypertension with Comorbidities Treatment of Metabolic Risk Factors in Children and Adolescents

The Beneficial Role of Angiotensin- Converting Enzyme Inhibitor in Acute Myocardial Infarction

Angiotensin IV and the Molecular Mechanisms Involved in the Development of Insulin Resistance in 3T3-L1 Adipocytes

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Earlier studies, mainly in rodents, have shown that diabetic

METABOLISMO E VITAMINA D

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

CKD Satellite Symposium

Managing the Low Output Low Gradient Aortic Stenosis Patient

Diabetes Mellitus and Breast Cancer

A Comparative Analysis of Capillary Density in the Myocardium of Normotensive and Spontaneously Hypertensive Rats

Diabetes and the Heart

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Signal Transduction Pathway Smorgasbord

I have nothing to disclose.

J Jpn Coll Angiol, 2009, 49:

The Therapeutic Potential of Novel Approaches to RAAS. Professor of Medicine University of California, San Diego

Cardiovascular Complications of Diabetes

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Losartan Improves Exercise Tolerance in Patients With Diastolic Dysfunction and a Hypertensive Response to Exercise

Effects of Losartan and Amlodipine on Left Ventricular Remodeling and Function in Young Stroke-Prone Spontaneously Hypertensive Rats

ORIGINAL REPORTS: OBESITY

OMICS Journals are Welcoming Submissions

Supplementary Figure 1:

HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME

Insulin resistance influences 24h heart rate and blood pressure variabilities and cardiovascular autonomic modulation in normotensive healthy adults

-adrenergic receptor subtypes blockade on the rat myocardium inotropy

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supporting Information

When should you treat blood pressure in the young?

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Experimental Procedures. Systolic, diastolic and mean BP levels and heart rate were measured using a

Sacubitril/Valsartan unter der Lupe Subgruppenanalysen, real world data,

Transcription:

AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY SA Oliveira Jr, MP Okoshi, PF Martinez, DM Guizoni, BP Torres, M Dal Pai-Silva, K Okoshi, CR Padovani, AP Lima-Leopoldo, AC Cicogna 1 Federal University of Mato Grosso do Sul, Campo Grande, Brazil Sao Paulo State University, Botucatu Medical School, Brazil There is not any conflict of interest regarding the current presentation.

BACKGROUND

Cardiac remodeling Adaptive process to maintain myocardial performance in response to stress conditions Cardiac remodeling involves myocyte hypertrophy, interstitial fibrosis and molecular modifications Cohn JN, Ferrari R, Sharpe N. J Am Coll Cardiol, 2000;35(3):569-82 Barry S, Davidson S, Townsend P. Int J Biochem Cell, 2008;40(10):2023-39

Cardiac remodeling Differential molecular mechanisms can interact in multiple points of the cytosol in cardiac remodeling Important connection (cross-talk) between the signal transduction pathways that mediate insulin and angiotensin II actions in the heart Cardiac Remodeling and Insulin Resistance Cooper S, et al. Am J Physiol-Heart Circ Physiol. 2007;293(4):H2009-23 Bertrand L, et al. Cardiovasc Res, 2008;79(2):238-48

Regulation of insulin signaling Insulin actions are highly regulated by several factors Regulatory mechanisms attenuate metabolic signaling from insulin stimuli by decreasing Tyrosine phosphorylation of proteins members from insulin pathway, as insulin receptor (IR), insulin receptor substrate (IRS) and phosphatidilinositol 3-kinase (PI3K) messenger Insulin resistance is a common pathological state in which target cells fail to respond to normal stimuli from circulating insulin

Molecular mechanisms of angiotensin II signaling Elevations in angiotensin II (Ang-II) contribute to stimulation of Ang-II type 1 (AT1) receptor: remodeling and insulin resistance in the heart Velloso, Folli, Perego, et al.; Diab Metab Res Rev 2006; 22(1):98-107 Olivares-Reyes, Arellano-Plancarte, Castillo-Hernandez; Mol Cell Endocrinol 2009; 302(1):128-39

Cross-talk between Ang-II and insulin in Obesity Clinical studies/ genetic models of obesity (Zucker rats): Interventions with ACE inhibitors or AT1 receptor blockade: - attenuation of metabolic and endocrine disorders; - normalization of arterial pressure as well as remodeling and insulin resistance in the heart Ang-II and insulin interaction in models of diet-induced obesity Fogari et al.; Hypertens Res 2005;28(3):209-14 Ernsberger et al.; Am J Hypertens. 2007;20(8):866-74 Carvalheira et al.; Endocrinology. 2003;144(12):5604-14

HYPOTHESIS Hypercaloric diet-induced obesity has been associated with metabolic and cardiovascular disorders, including remodeling and insulin resistance in the myocardium

OBJECTIVE

OBJECTIVE To evaluate the influence of angiotensin-ii type I (AT1) receptor blocker losartan on insulin receptor/ phosphatidylinositol 3-kinase pathway and myocardial remodeling in rats with diet-induced obesity

METHODS

Animals and experimental design Wistar-Kyoto rats (60 days-old) Control group (C) Obese group (OB) C CL OB OBL Experimental period: 30 Weeks 5 Weeks C groups: animals submitted to commercial rat chow (3.2 kcal/g) OB groups: animals submitted to hypercaloric diet (4.6 kcal/g) L groups: groups treated with Losartan (30 mg/kg/day)

Nutritional and metabolic parameters Body weight (g) Adiposity (AD): AD=[epididymal fat (EF) + retroperitoneal fat (RPF)] 100 (body weight sum of fat pads) Glycemia was obtained from glucose tolerance test Insulin concentration (ELISA) Cardiovascular parameters Systolic blood pressure (SBP) was assessed, using a noninvasive tail-cuff method (pletismography) Morfological study integrated myocyte cross-sectional area and collagen interstitial fraction determination

Cardiovascular parameters Molecular expression of following proteins (Western blot): - β subunit of insulin receptor (βri) antibodies against βri (sc-711) and phospho-tyr 1162 -βri (sc-25103) - p85 subunit of phosphatidylinositol 3-kinase (p85/pi3-k) antibodies against p85/pi3k (sc-1637) and phospho-tyr 508 - p85/pi3k (sc- 12929) - Protein levels were normalized to those of GAPDH (6C5, sc-32233, Santa Cruz Biotechnology) Martinez et al.; Med Sci Monit 2010; 16(12):BR374-83

Proceedings of statistical analyses Results were evaluated by two-way analysis of variance (ANOVA) When significant differences were found (p<0.05), the post hoc Tukey s multiple comparisons test was carried out The level of significance was considered to be 5%. Bayley; J Am Stat Assoc 1977; 72: 469-78 Norman & Streiner; Biostatistics: the bare essentials. 1994

RESULTS

Nutritional, metabolic and cardiovascular profile Table 1. Nutritional, metabolic and cardiovascular results according groups Variables Groups C OB CL OBL Body weight (g) 553 ± 40 644 ± 45 * 552 ± 44 645 ± 63 Adiposity (%) 6.0 ± 1.0 12.0 ± 2.3 * 6.4 ± 1.3 11.3 ± 2.3 Glycemia (AUC) 26,345±1,935 34,841±1,836 * 26,520±1,840 31,300±1,836 Insulin (ng/dl) 1.64 ± 0.41 2.89 ± 0.37 * 1.03 ± 0.21 * 2.06 ± 0.20 # SBP (mmhg) 115.3 ± 4.5 124.0 ± 9.7 * 108.7 ± 7.6 * 112.2 ± 13.9 # Results in mean±standard error; AUC: area under curve of responses to glycemic tolerance test; SBP: systolic blood pressure; * p<0.05 vs C; # p<0.05 vs OB group; p<0.05 vs CL group; ANOVA and Tukey s test

Cross-sectional area (µm 2 ) A Histological parameters of the heart C 400 * # B CL 300 200 OB OBL 100 C OB CL OBL Figure 1. Morphometric analysis of left ventricle; (A) histological sections stained with hematoxylin-eosin; (B) myocyte cross-sectional area, according group; results in mean and standard-error; * p<0.05 vs C group; # p<0.05 vs OB group; ANOVA and Tukey s test

Interstitial collagen fraction (%) A Histological parameters of the heart C 6 * * B 5 OB 4 3 2 CL 1 C OB CL OBL OBL Figure 2. Morphometric analysis of left ventricle; (A) histological sections stained with picro-sirius red; (B) interstitial collagen fraction according groups; results in mean and standard-deviation; * p<0.05 vs C; # p<0.05 vs OB; p<0.05 vs CL; ANOVA and Tukey s test

Tyr 1162 -βir/ βir βir/ GAPDH 3,0 2,5 A Figure 3. Protein levels of insulin 2,0 receptor in cardiac muscle 1,5 analyzed by Western blotting. (A) β-subunit of insulin receptor (βir); βir protein levels normalized to the GAPDH levels. (B) phospho- 1,0 0,5 0,0 C OB CL OBL Tyr 1162 -βri expression; protein levels normalized to the βri total 4 # B levels; results in mean and standard-deviation; * p<0.05 vs C; # p<0.05 vs OB; p<0.05 vs CL; 3 2 * * ANOVA and Tukey s test. 1 0 C OB CL OBL

Tyr 508 -PI3K/ PI3K PI3K/ GAPDH 4 A Figure 4. Protein levels of p85 3 subunit of phosphatidylinositol 3- kinase (PI3K) in cardiac muscle 2 * analyzed by Western blotting. (A) PI3K expression; PI3K protein 1 levels normalized to the GAPDH levels. (B) phospho-tyr 508 -PI3K 0 C OB CL OBL expression; protein levels normalized to the PI3K total levels; results in mean and standard-error; * p<0.05 vs C; # 4 3 2 * # B p<0.05 vs OB; p<0.05 vs CL; ANOVA and Tukey s test. 1 0 C OB CL OBL

CONCLUSION

CONCLUSION Losartan attenuates insulin resistance and myocardial remodeling in obese rats. Financial support: FAPESP