Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny 2, 3, Liang Cheng, Nihal Ahmad 6 and Xiaoqi Liu 1, 3 1 Department of Biochemistry, 2 Department of Biological Sciences, 3 Center for Cancer Research, 4 Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 4797, U.S. Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN 462, U.S. 6 Department of Dermatology, University of Wisconsin, Madison, Wisconsin 376, U.S. To whom correspondence should be addressed: Department of Biochemistry, Purdue University, 17 S. University Street, West Lafayette, IN 4797, Tel: 76-496-3764; Fax: 76-494-7897; E-mail: liu8@purdue.edu. Supplementary Experimental Procedures Supplementary Figure Legends Supplementary Figures
Supplementary Experimental Procedures Cell cultures and transfection- DU14 (Pten wild-type) and (Pten null) cells were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 1% (vol/vol) fetal bovine serum, 1 units/ml penicillin, and 1 units/ml streptomycin at 37 C in % CO 2. LNCap cells were cultured in RPMI-164 medium. RWPE-1 (an immortalized cell line derived from normal human adult prostate) cells were cultured in keratinocyte Medium (Invitrogen). Plasmid DNA was transfected with MegaTran (ORIGENE) as described by the manufacturer. Construction of vectors- vector was from Addgene (Plasmid 1339). RNAi- To deplete endogenous Pten, plko.1-pten plasmids (TRCN274, TRCN2746, TRCN2748, Sigma) was transfected into cells, followed by puromycin (1 ug/ml) selection. To knock down endogenous Plk1, sirna (targeting sequence: AAGGGCGGCTTTGCCAAGTGCTT, Dharmacon) was transfected into cells. Fluorescence in site hybridization (FISH) and chromosome spreading- For FISH experiments, interphase cells were harvested by trypsinization and washed with PBS. Cells were then swollen in 6 mm KCl for min at 37 o, fixed in Carnoy s solution (3:1 of methanol: glacial acetic acid), dropped onto slides, and dried at room temperature. The slides were stained with Cytocell enumeration probes against chromosome 2 conjugated with Texas Red (LPE2R-A), according to the manufacturer s protocol. For chromosome spreading, cells were treated with nocodazole for 16h and harvested by mechanic shake-off. Cells were then swollen in 6 mm KCl for min at 37 o, and fixed in Carnoy s solution, dropped onto slides, and dried at room temperature. The slides were stained with DAPI. Immunofluorescence staining- Cells were fixed in 4% paraformaldehyde, treated with cold menthol, and stained with phospho-histone H3 (Serine 1) antibody (Millipore), followed by AlexaFluro88 anti-rabbit antibody (Invitrogen) for detection. Western blotting- Cells lysates were prepared in AMI lysis buffer (Active Motif). Equal amounts of protein were resolved on 1% polyacrylamide gels and subjected to immunoblotting with the following antibodies: anti-plk1 (Santa Cruz Biotechnology), anti-pten (Cell Signaling), anti-cleaved PARP (Millipore), and anti- (Sigma). Immunohistochemisty (IHC)- Murine or human patient tissues were fixed in 1% neutral buffered formalinand embedded in paraffin. Immunohistochemistry was accomplished with biotinylated secondary antibodies with the Elite Vectastain ABC kit and peroxidase substrate diaminobenzidine kit ( Laboratories). In brief, sections were deparaffinized, rehydrated, and antigens were retrieved using the 21-Retriever (PickCell Laboratories) and antigen unmasking solution ( Laboratories). After samples were blocked with the MOM blocking reagent ( Laboratories), samples were incubated with primary antibodies (Plk1, 1:1, sc-17783, Santa Cruz Biotechnology; p-akt, 1:, 46, Cell
Signaling) at 4 C overnight. The signal was visualized by diaminobenzidine (DAB) and -bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium sequential detection following the manufacturer s ( Laboratories) recommendations. Human prostate cancer tissue array slides (PR87a) were purchased from US Biomax. Cell viability assay- Cells were grown in 96-well plates. After inhibition of Plk1 by BI 36 treatment, the relative numbers of viable cells in culture were determined using the CellTiter-Glo Luminescent Cell Viability Assay kit, which evaluates the presence of ATP, an indicator of metabolically active cells (Promega). Soft agar quantitative assay- Cells were grown on soft agar in 6-well plates. After BI 36 treatment for 7 days, the colony numbers in each well were determined with the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega).
Supplementary Figure Legends Fig S1 Generation of Pten-depleted DU14 cell line. DU14 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. Fig S2 Mitotic stress of Pten-depleted cells depends on Pten nuclear function, but not its phosphatase activity. (A-B) Re-introduction of in cells attenuates the response to mitotic inhibitors. control or -expressing cells were treated with nocodazole (8 or 16 nm) in A, taxol ( or 1 nm) in B, or DMSO for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <., not significant). (C-D) cells were transfected with GFP vector, -WT, -K13, 289E, or Myc-Pten-C124S, followed by Western blotting or immunofluorescence staining. Scale bar: 1 µm. (E-F) cells were transfected with GFP vector, -K13, 289E, or Myc-Pten-C124S, and treated with nocodazole in E, or taxol in F. Mitotic index was determined by phospho-histone H3 staining ( p <., not significant). Fig S3 Hypersensitivity of Pten-depleted cells to Plk1 inhibition is independent of targeting sites of Pten RNAi. (A) DU14 cells were transfected with plko.1-pten plasmid 1 (2746), plko.1-pten plasmid 2 (2748), or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. (B) The cells as in A were treated with BI 36 for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <.). (C) The cells as in A (, cells from each cell line) were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.). Fig S4 Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. (A) DU14 control and Pten-depleted cells were transfected with sirna to knock down Plk1 for 36 h, and harvested for phospho-histone H3 staining to determine mitotic index ( p <.). (B) DU14 control and Pten-depleted cells (,) were grown on 96-well plates, depleted of Plk1 by sirna, and harvested for cell viability assay in the following three days ( p <.). Fig S Generation of Pten-depleted RWPE-1 cells. RWPE-1 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting.
Fig S6 Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attenuates the response to Plk1 inhibition. (A) cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to FACS analysis after 12 h treatment (left panel), or phospho-histone H3 staining to measure mitotic index after 1 h treatment (right panel). ( p <.) (C) The cells as in A were treated with BI 36 (1 or nm) or DMSO for 16 h, and analyzed by cleaved PARP Western blotting to examine apoptosis (left panel)., cells from each cell line were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay (right panel). ( p <.) (D-E) PC3 cells were transfected with GFP vector or different Pten constructs (-K13, 289E or Myc-Pten-C124S), treated with BI 36, and harvested for phospho-h3 staining in D, or cell viability assay in E. ( p <., not significant) Fig S7 Re-introduction of in LNCap cells attenuates the response to Plk1 inhibition. (A) LNCap cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to phospho-histone H3 staining to measure mitotic index after 1 h treatment ( p <.). (C), cells from each cell line as in A were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.).
Figure S1. Generation of Pten-depleted DU14 cell line. Pten DU14 Con Pten-
Figure S2. Mitotic stress of Pten-depleted cell depends on Pten nuclear function, but not its phosphatase activity A C 1 Control 8 16 Nocodazole (nm) B D 1 Green Control 1 Taxol (nm) DNA Merge Mock -K13,289E Myc-Pten-C124S GFP Pten Pten-WT Pten-K13,289E E 3 1 Pten-K13,289E Pten-C124S 8 16 Nocodazole (nm) F 1 Pten-K13,289E Pten-C124S 1 Taxol (nm)
Figure S3. Hypersensitivity of Pten-depleted cells to Plk1 inhibitioin is independent of targeting sites by Pten RNAi A B C Pten Con Pten RNAi 2746 2748 3 1 Con RNAi Pten RNAi-2746 Pten RNAi-2748 1 cell viability (%) 1 8 6 4 Con RNAi Pten RNAi-2746 Pten RNAi-2748 1 1
Figure S4. Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. A Plk1- Plk1- + PtenpH3-positive cells (%) 3 1 B cell viability (%) 1 8 6 4 Control Pten- 24 48 72 hours after Plk1 RNAi
Figure S. Generation of Pten-depleted RWPE-1 cell line. Pten Plk1 RWPE-1 Con Pten-
Figure S6. Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attanuates the response to Plk1 inhibition. A Control Pten B control GPF-Pten Mock 1 G2/M=3% G2/M=41% G2/M=8% G2/M=24% G2/M=28% G2/M=4% 2N 4N 2N 4N 2N 4N 3 1 Control 1 C Cleaved PARP D 3 1 Plk1 Pten-K13,289E Pten-C124S Control 1 1 1 E cell viability (%) cell viability (%) 1 8 6 4 1 8 6 4 _Control _ 1 1 1 1 Pten-K13,289E Pten-C124S
Supplementary Figure S7. Re-introduction of in LNCap cells attanuates the response to Plk1 inhibition. A B C Pten LNCap 1 LNCap 1 cell viability (%) 1 8 6 4 LNCap 1 1