A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently registered with the TGA
Background The rearrangement of chromosome 9 and 22 leads to the Philadelphia Chromosome formation, characterized by the BCR-ABL translocation ABL BCR Chromosome 22 BCR ABL Depending on chromosomal breakpoint locations, different isoforms of BCR and ABL genes fusion are possible; the most common are: p210 (Mbcr) b2a2, b3a2 p190 (mbcr) e1a2 BCR-ABL translocation is responsible for neoplastic transformation: Chromosome 9 Chromosome Philadelphia 95% Chronic Myeloid Leukemia 30% Acute Lymphoblastic Leukemia
Diagnostic work-up of Philadelphia Positive Leukemias Blood withdrawal: complete cell count = hematologic disorder Morphologic analysis on peripheral blood/bone marrow = diagnosis of Acute Lymphoblastic Leukemia = Suspiction of Chronic Myeloid Leukemia Conventional Reverse Transcription- PCR Genetic testing Molecular qualitative, karyotype, FISH Immunophenotyping, flow-cytometry = diagnosis of subtype of Leukemia = risk stratification = Van Dongen et al, Leukemia 1999 TREATMENT Molecular quantitative genetic testing
Limitations of conventional RT-PCR
Limitations of conventional RT-PCR Total RNA Reverse Transcription Amplification by PCR Gel electrophoresis 3 hours TIME CONSUMING MULTISTEP LACK OF INTERNAL CONTROL LABORIOUS SUBJECTIVE INTERPRETATION In-House/Homebrew
Faster Results Enhanced patient management CLINICAL & Scientific NEEDS Improved Reliability Easy adoption Easy set-up
Q-LAMP : Multi-plex and Real Time Isothermal Amplification Techniques due to their intrinsic characteristics can overcome the limitations of conventional PCR NON-PCR method Notomi T et al, NAR 2000 further improved by DiaSorin Q-LAMP
What is LAMP? LAMP is Loop-Mediated Isothermal Amplification 1. Loop-mediated Refers to the loop structures formed when the LAMP primers bind to target DNA sequence 2. Isothermal Reaction takes place at a single temperature (usually 63-67 o C) - relatively simple instrumentation 3. Amplification Target is amplified using a combination of intricate primer design and a polymerase enzyme with strand displacement activity The Diagnostic Specialist
How DiaSorin Q-LAMP is achieved Amplification monitoring (real-time) in Q-LAMP achieved Q-Primers. Fluorescent molecule conjugated to one end of the Q-Primer LED in the LIAISON Iam instrument excites it Unique property of fluorescence molecule - quenched when incorporated into amplicon: TTATTAGAGGTTCAGACAATAGGTTAGGAA CTCCAAGTCTGTTATCCAATC Quenched DYE 1. Maximum fluorescence when primer is unbound 2. Fluorescence quenched when primer binds target The Diagnostic Specialist
Tt (min) Basic Principles Q-LAMP quantitation Decrease in fluorescence over time (quenching) used to monitor progress of reaction. Time taken to reach X% decrease in signal is called the Threshold Time (Tt) 23 20 X% Quenching 17 14 11 Sample Tt y = -1.7x + 26.2 R² = 0.99 8 5 1 3 5 7 9 11 Log copies/ml Threshold Time RESULT The Diagnostic Specialist
Q-LAMP vs RT-PCR Steps Enzymes PCR Temperature Enzymes Q-LAMP Temperature Reverse Transcription 1 step, 1 enzyme, 1 temperature, Reverse close tube Transcriptase format 70 C 42 C 99 C Amplification DNA Thermostable Polymerase 4 C 94 C, 30 sec (Denaturation) 65 C, 60 sec (Annealing) 72 C, 60 sec (Polymerization) LAMP Polymerase 35x 65 C
Simple Procedure 1 2 3 4 Buffer Freezedried reagents Reconstitution of lyophilized reagents Aliquote in tube strip Addition of controls and samples RNA Loading on Liaison Iam
Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription DNA Amplification Internal Control Real Time Rapid
Q-LAMP for BCR/ABL Translocation: Triplex Multiplex BCRABL p190/p210/gusb p190 p210 GUSb To validate negative results by excluding: incorrect extraction procedure low quality of extracted RNA presence of inhibitors incorrect reaction conditions
Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA cdna Amplification + Reverse Transcription signal detection Internal Control Real Time
Q-LAMP vs RT- PCR Temp ( C) PCR Amplification X 35 cycles Time 1 step, 1 enzyme, 1 temperature, close tube format Multiplex Temp ( C) Internal Control Real Time Q-LAMP Constant Amplification Time Rapid
Rapid solution Incubation @ constant temperature avoiding thermocycling Employment of a unique enzyme for RT and amplification High efficiency (characteristic of LAMP) 60 min 20 min 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription cdna Amplification + signal detection Internal Control Real Time Rapid
Instrumentation Liaison IAM incubation constant T real time reading of fluorescence (3 channels) automatic elaboration of data Compact Design 8 wells
Q-LAMP BCR-ABL performance: Verification SPECIFICITY Specificity established on negative RNA and NTC (water): Negative cell lines Replicates HL-60 343 KASUMI 23 NB4 24 TOT replicates 390 BCR-ABL Results Negative* *validated through amplification of Gusb endogeneous control 100% specificity No Target Control Replicates BCR-ABL Results water 312 No amplification* *absence of primers dimers
Q-LAMP BCR-ABL performances SENSITIVITY 10-2 mut into wt dilution is the minimum amount of mutation found at the disease onset Sensitivity established on serial dilutions of mutated RNA into wild type RNA: Dilution tested (K562 RNA into HL60 RNA) BCR-ABL p210 % Detection #Reps 10-2 100% 78 10-3 100% 78 Dilution tested (TOM1 RNA into HL60 RNA) BCR-ABL p190 % Detection #Reps 10-2 100% 78 10-3 100% 78 Sensitivity required for diagnosis
RESULTS RT-PCR Q-LAMP BCR-ABL performances COMPARISON with RT-PCR on CLINCAL SAMPLES 85 samples RESULTS Q-LAMP BCR-ABL BCR-ABL p190 BCR-ABL p210 Negative TOT Average detection time for positive samples: 20 min BCR-ABL p190 29 - - 29 BCR-ABL p190-30 - 30 Negative - - 26 26 TOT 29 30 26 85 100% concordance
Faster Results Real time monitoring: 20 min for detection of +ve 60 min reaction time fo r Neg Control Better utilization of resources Validated, QA etc Timely administration of correct therapy Early identification of appropriate monitoring method Enhanced patient management MET CLINICAL NEEDS Improved Reliability Close tube/single step format Internal control Less risks of procedural errors Automatic elaboration of data Small Analyser Easy adoption Easy set-up Lyophilized reagents, Simple single-step procedure Less risks of procedural errors
Thank you!!! Giulia Amicarelli: Molecular Scientific Affairs Manager Paul Eros: Vice President Molecular Marketing AIMS Organising Committee