TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection

TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection Amy Lee, Arbutus Biopharma DIA/FDA Oligonucleotide-Based Therapeutics Conference September 9 Washington, DC

Disclaimer The views and opinions expressed in the following PowerPoint slides are those of the individual presenter and should not be attributed to DIA, its directors, officers, employees, volunteers, members, chapters, councils, Communities or affiliates, or any organization with which the presenter is employed or affiliated. These PowerPoint slides are the intellectual property of the individual presenter and are protected under the copyright laws of the United States of America and other countries. Used by permission. All rights reserved. DIA and the DIA logo are registered trademarks or trademarks of Drug Information Association Inc. All other trademarks are the property of their respective owners. 2015 DIA, Inc. All rights reserved.

Chronic HBV Global Unmet Medical Need 350M people chronically infected with HBV 780K people die every year as a consequence of HBV Approved treatments control viral load but do not cure the infection 3

TKM-HBV Therapeutic Objective The goal of TKM-HBV is to facilitate the loss of HBV surface antigen (HBsAg) in chronic HBV patients by: Reducing levels of HBV surface antigen by inhibiting its production (not simply blocking secretion) HBsAg is thought to promote host immune tolerance of the virus Thus its removal should promote immune recognition and viral clearance Inhibiting production and function of all other Hepatitis B proteins & viral RNAs, including the replication intermediate Use in combination with other anti-hbv therapeutics including nucleos(t)ide (NUC) standard of care or investigational drugs (e.g., core protein inhibitors) 4

RNA Interference Approach to Chronic HBV A Distinct and Complementary Mechanism of Action NUC intervenes at pregenomic RNA conversion to HBV genomic DNA NUC do not inhibit production of viral proteins incl. HBsAg Anti-HBV sirna intervenes by cleaving viral mrna & pgrna reducing production of all HBV proteins (HBsAg, HBcAg, HBeAg, polymerase, HBxAg) 5

Arbutus Lipid Nanoparticle Delivery Platform Enabling Nucleic Acid Based Therapeutics LNP encapsulate, protect and deliver the drug payload Enables efficient cellular uptake and intracellular release Payload types: sirna, UsiRNA mrna, mirna etc 6

7

Accumulated LNP Experience in Human Eight Products have Entered the Clinic Since 2008 Representative Ongoing Clinical Activity Product Company Phase Indication Comments ALN-TTR02 Alnylam 3 Amyloidosis Potent pharmacodynamic effect demonstrated, well tolerated TKM-PLK1 Arbutus 2 Oncology Promising signs of RNAi drug activity TKM-Ebola-Guinea Arbutus 2 Ebola infection Strong survival benefit in primates with high pre-existing viral titres 9 th product IND application filed recently (DCR-PH1 for primary hyperoxaluria, Dicerna) > 250 patients treated w/ sirna-lnp, some with repeat-dosing for >1 year Potent, long lasting effects after a single dose Continually growing body of clinical safety data since 2008 LNP enabled RNAi drugs have strong clinical validation 8

Established cgmp Manufacturing Expertise Controlled self assembly Highly scalable to kgs Lyophilizable Efficient Consistent particle size Particle Formation Skid in Arbutus cgmp Facility (suitable for 100g+ batches) 9

Rationale for RNAi Approach to Treatment of Chronic HBV LNP Technology Platform for RNAi Trigger Delivery TKM-HBV Drug Design Preclinical Pharmacology Clinical Development & Future Directions 10

Targeting Multiple Hepatitis B Viral Transcripts Primary target is HBsAg cccdna sirna sites that target 3 viral transcripts sirna site that targets all 4 transcripts RNAi-mediated cleavage anywhere along 2.1/2.4 kb mrnas will destroy sag transcripts All lead triggers target the sag 2.1/2.4 kb mrnas Triggers also cleave 3.5 kb and 0.7 kb mrna and pgrna with potential for additional therapeutic benefit by reducing HBc, HBe & HBx Inclusion of 3 RNAi triggers allows for broad knock down of all viral antigens, pan-genotypic activity, and mitigation of viral resistance 11

Advantages of a Multi-Trigger Approach Single-Trigger Selection of Resistant Mutants in WHV Model Normalized individual results Group geometric means Doses: Doses: 2-log knockdown of viral DNA achieved with single-trigger siwhs siwhx less effective, but more sustained effect Rapid viral recrudescence while on repeat-dose sirna therapy Evaluated sirna target sites for changes that could confer resistance Collaboration with Bristol-Myers Squibb 12

Advantages of A Multi-Trigger Approach Sequencing Identifies Potential Resistance Mutations Effect of single-trigger siwhs not sustained through dosing period Viral DNA was extracted from all siwhs- and siluc-treated animals at Days 0 and 28 and sequenced across the siwhs target site Animal sirna Day 0 Sequence at siwhs Target Site Day 28 Sequence at siwhs Target Site 6193 siluc ACAACAGTCAATTGCAGACAA ACAACAGTCAATTGCAGACAA 6721 siluc ACAACAGTCAATTGCAGACAA ACAACAGTCAATTGCAGACAA 6539 siwhs ACAACAGTCAATTGCAGACAA ACAACARTMAMTTGCAGACAA 6323 siwhs ACAACAGTCAATTGCAGACAA ACAACADYMAMTTGCAGACAA 6597 siwhs ACAACAGTCAATTGCAGACAA ACAACADTMAMTTGCAGACAA Multiple mutations in siwhs target site present in all siwhs-treated animals at Day 28, but not in any other animals Mutations in siwhx target site were not detected in any animals, consistent with continued effects of siwhx throughout the dosing period Collaboration with Bristol-Myers Squibb 13

Rationale for RNAi Approach to Treatment of Chronic HBV LNP Technology Platform for RNAi Trigger Delivery TKM-HBV Drug Design Preclinical Pharmacology Clinical Development & Future Directions 14

TKM-HBV Targets All Hepatitis B Genotypes Triggers selected from regions of high conservation in viral genome Increased universality by combining 2+ UsiRNA Genotype A B C D E F G H A-D A-H Trigger 1 % Target 99 93 90 97 98 96 99 97 94 94 Trigger 2 Sites w/ Conserved 99 95 95 97 93 99 100 90 96 96 Trigger 3 Core 98 99 99 96 97 99 96 97 98 98 Each chosen target site is conserved in 94% known HBV genomes 3-trigger cocktail has 1 perfect match to 99.8% of viral genomes 15

TKM-HBV Acts Against Multiple Genotypes Infected Primary Human Hepatocyte Model 120 Genotype A 120 Genotype B Untreated Luc-LNP HBsAg as % Untreated 100 80 60 40 20 HBsAg as % Untreated 100 80 60 40-96% 20-96% TKM-HBV 0 0 Entecavir 120 Genotype C 120 Genotype D HBsAg as % Untreated 100 80 60 40 20 HBsAg as % Untreated 100 80 60 40-94% 20-98% 0 0 16

Verification of Molecular Mechanism of Action HBV mrna Silencing in HepDE19 Stably Transfected Cell Model Site-specific cleavage of viral RNA by TKM-HBV confirmed using 5 -RACE PCR 3.5 kb 2.4 kb 2.1 kb 0.7 kb HBV transcripts 5 RACE Assay for Target Site 1 UsiRNAs cleave HBV RNAs at target sites 5 RACE Assay for Target Site 2 5 RACE Assay for Target Site 3 PCR-amplified product is of expected size Verified exact mrna cleavage locations via direct & clonal sequencing 17

Verification of Molecular Mechanism of Action HBV mrna silencing in HDI Mouse and HepDE19 Cells >90% silencing of viral mrna with rapid onset Strong effect on 2.1/2.4 kb mrnas encoding sag, as well as other transcripts % Untreated 120 100 80 60 40 Hepatic mrna bdna assay Hepatic HBV mrnas (all) Hepatic 3.5 kb RNA Probe Set 1 (Blue curve) Northern Blot 1 2 3 4 5 3.5 kb 2.4 kb 2.1 kb 3.5 kb 2.4 kb 2.1 kb 0.7 kb Probe Set 2 (maroon curve) 1 Non targeting control 2 Cocktail 1,2,3 3 UsiRNA 1 4 UsiRNA 2 5 UsiRNA 3 HBV transcripts 20 0 0 7 14 Day 18s rrna 18

Rapid Onset of Action Hepatic mrna Hepatic Protein Secreted Viral Particles 120 120 120 100 Hepatic HBV mrnas (all) Hepatic HBV RNAs (3.5 kb) 100 Hepatic HBsAg (ELISA) Hepatic HBcAg (IHC) 100 Serum HBsAg Serum HBV DNA % Untreated 80 60 % Untreated 80 60 Core protein inhibition in IHC images on next slide % Untreated 80 60 40 40 40 20 20 20 0 0 7 14 Day 0 0 7 14 Day 0 0 7 14 Day Reductions of target mrna and downstream viral products within 1+ days 19

Rapid Onset of Action Hepatic HBV Surface Ag Day 0 Day 1 Day 7 Day 14 Hepatic HBV Core Ag Day 0 Day 1 Day 7 Day 14 Intrahepatic HBV surface and core antigen reductions detected by IHC Reduction of intracellular surface Ag is rapid (nadir at Day 1) followed by core Ag (nadir at Day 7) 200 μm 20

Validation of RNAi-LNP Approach in Chimpanzee Human HBV has narrow host range Efficient infection well-documented only for human and chimpanzee Δ HBsAg (log 10 pg/ml) (relative to Day 0) Single sirna-lnp dose at iv 0.25 mg/kg 0.5 0.0-0.5-1.0-1.5 0.5 to 1 log decrease in sag 1 to 2 log decrease in viral titre 1 to 2 month duration of effect Normalized Serum sag HBV sirna -LNP 0 20 40 60 80 100 Days Control sirna -LNP 4 chimpanzees studied; some interpretation challenges, widely variable titres A B C D Δ Viral Load (log 10 copies/ml) (relative to day 0) 1 0-1 -2-3 Normalized Viral Titre HBV sirna -LNP 21 Control sirna -LNP A B C D 0 20 40 60 80 100 Days Sepp-Lorenzino et al. Sirna Therapeutics Merck Alnylam

Antiviral Activity in HBV-Infected Chimeric Mouse TKM-HBV Inhibits HBV Antigens and Viral Replication Removes viral products from peripheral and intracellular compartments Viral cccdna is reduced by TKM-HBV Serum HBsAg as % Baseline 120 100 80 60 40 20 0 Treatments Untreated Serum HBsAg TKM-HBV 0.3 mg/kg 0 7 14 21 28 35 42 Day % Untreated at Day 32 125 100 75 50 25 0 Serum eag -75% Day 32 % Untreated at Day 42 125 100 75 50 25 0 Liver HBV DNA cccdna Liver Serum Day 42 22

Antiviral Activity in HBV-Infected Chimeric Mouse TKM-HBV Inhibits HBV Antigens and Viral Replication Removes viral products from peripheral and intracellular compartments Saline Control Luc-LNP TKM-HBV Liver surface Ag Liver core Ag 23

TKM-HBV Complements NUC Standard of Care No antagonism of either drug action in infected chimeric mice Serum HBV DNA Serum HBsAg Serum HBV DNA as % Baseline) 100 10 1 0.1 Saline Entecavir, daily oral TKM-HBV, weekly iv Entecavir + TKM-HBV Daily Entecavir Treatment S erum HB sag as % Baseline 100 10 Saline Entecavir, daily oral TKM-HBV, weekly iv Entecavir + TKM-HBV Daily Entecavir Treatment -7 0 7 14 21 28 35 Day Weekly LNP -7 0 7 14 21 28 35 Day LNP 24

TKM-HBV Preclinical Pharmacology Summary Advantages of 3-trigger approach: Multi-component payload combines strengths of individual triggers Inhibits replication, reduces HBV DNA, sag, eag, cag and cccdna Increases universality in diverse patient populations, across genotypes Reduces potential for anti-viral resistance RNAi drug mechanism of action is well -characterized Complementary to NUC standard of care, works well in combination Well-validated LNP delivery technology Clinical experience from multiple programs, incl. repeat-dosing > 1 yr POC in chimpanzee model of chronic HBV using earlier-generation LNP TKM-HBV uses 3rd-gen LNP formulation technology with improved potency 25

TKM-HBV Program Clinical Development: Phase 1 SAD study in healthy volunteers (Canada) ongoing Phase 2a MAD study in HBV patients taking NUCs Next Steps: Explore combinations with established and investigational drug classes 26

Arbutus HBV Development Pipeline Addressed HBV Persistence Factor* Stage of Development Candidate/Program HBV Replication Inhibition Immune System Stimulation/ Reactivation cccdna Formation Inhibition/ Elimination Research Lead Optimization Preclinical IND Enabling Phase I TKM-HBV (RNAi) TKM-PLK1** (RNAi) OCB-030 (Cyclophilin Inhibitor) CYT003 (TLR9 Agonist) cccdna Formation Inhibitor Surface Antigen Secretion Inhibitor Core Protein/Capsid Assembly Inhibitors (2 Candidates) cccdna Epigenetic Modifier STING Agonist *Darker colored circles denote most pronounced activity of candidate/program **TKM-PLK1 is currently undergoing evaluation in Phase I/II clinical trials for oncology indications GI-NET/ACC and HCC. 27

Our Strategy All Needed Assets Under One Roof HBV biology is more complex than HCV Curative therapy requires a combination to overcomes three pillars of viral persistence: 1. Replicating continually in liver hepatocytes 2. Expressing viral antigens that suppress the patients immune response 3. Establishing stable cccdna reservoir in nucleus Our unique set of assets allow for efficient development of drug combinations acting by complementary mechanisms of action Suppress Viral Replication Reactivate/ Stimulate the Immune System Eliminate cccdna Near term-goal: Increase cure rates with finite dosing duration Ultimate goal: All oral curative regimen To succeed in achieving an HBV Cure, all facets of HBV persistence need to be addressed 28

Acknowledgements Contributing Scientists Emily Thi Ammen Dhillon Xin Ye Luying Pei Nicholas Snead Janet Phelps Alice Li Jennifer Cross Trisha Barnard Sandie Du Ian MacLachlan LNP Formulation Chemistry James Heyes Bristol-Myers Squibb Siew Ho Scott Balsitis Steven Levine Joe Baldick Dan Tenney With support from many other parts of the Arbutus (formerly Tekmira) organization 29

Ask