Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Similar documents
Supplementary Information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

SUPPLEMENTARY METHODS

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Supplementary Materials and Methods

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Pair-fed % inkt cells 0.5. EtOH 0.0

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Supplementary Figures

Supplementary Information

Name Animal source Vendor Cat # Dilutions

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

ImmunoCAP. Specific IgE blood test

Supplemental Information

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer

Development Supplementary information

Supplementary Materials for

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Asthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Human Allergen Specific IgE ELISA Kits

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

Mouse Anti-HDM IgG Antibody Assay Kit

Supporting Information

Decreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Supplementary Information Titles Journal: Nature Medicine

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Materials for

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Supplementary Appendix

SUPPLEMENTARY INFORMATION

Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.

SUPPORTING MATREALS. Methods and Materials

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supporting Information

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Supplementary Materials and Methods

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA

Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy

ab LDL Uptake Assay Kit (Cell-Based)

Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer

Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Allergy. pp. 4 5 pp. 6 7 pp BAT Allergens Antibodies

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

LDL Uptake Cell-Based Assay Kit

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

SUPPLEMENTAL MATERIAL. Supplementary Methods

Supplementary Data Table of Contents:

Effective Targeting of Quiescent Chronic Myelogenous

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Transcription:

Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser, Jianping Zhao, Yongjian Xu, David J. Erle, and Guohua Zhen Supplementary Methods Biopsy Technique We brushed 10 sites within the subsegmental bronchi of right middle and lower lobes (10 gentle upward and downward strokes per site). We used forceps to biopsy left lower lobe carinae and fixed samples in polyoxymethylene. Histology and immunohistochemistry We stained 2 μm sections with hematoxylin and eosin (HE) or polyclonal rabbit anti-human IL-25 antibody (Abgent Biotech, China). Observers who were blinded to the clinical status of the subjects counted numbers of eosinophils/mm 2 submucosa and IL-25 positive cells/mm 2 epithelium, and calculated basement membrane thickness (BMT). We used the mean of 50 measurements taken over a distance of at least 1 mm to calculate BMT as previously described (1). Dual Immunofluorescent Staining Sections of bronchial biopsy were deparaffinized with xylene, followed by rehydration by immersing in 90, 70, and 50% ethanol, water, PBS. The sections were

permeabilized in PBS with 0.3% Triton X100. The sections were then incubated with mouse monoclonal antibody against MUC5AC at 1:150 dilution (45M1 clone; Sigma, USA) and rabbit polyclonal antibody against MUC5B at 1:150 dilution (H-300 clone; Santa Cruz, USA) at 4 C overnight. These sections were washed with PBST, and then incubated with Alexa Fluor 488 goat anti-mouse IgG for MUC5AC and Alexa Fluor 568 goat anti-rabbit IgG for MUC5B (Life Techonologies, USA) at 1:200 dilution in PBST for 2 h at room temperature. After incubation with secondary antibodies, the sections were washed again, stained with DNA stain 4', 6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, USA) at 1:300 dilution at room temperature and mounted. Dual immunofluorescent staining was examined using an Olympus BX-51 fluorescent microscope with appropriate filters (Olympus, Japan). Gene expression analysis We isolated total RNA from bronchial epithelial brushings and biopsies using TRIzol (Invitrogen, USA) and the RNeasy Micro Kit (Qiagen, USA), respectively and synthesized first-strand cdna using the PrimeScript RT reagent kit (Takara, Japan). We measured human IL-25, IL-33, TSLP, MUC5AC, MUC5B, CLCA1, POSTN, SERPINB10 in bronchial brushings and IL-17RB in biopsies using the Takara Perfect Real Time PCR kit, Takara SYBR Premix ExTaq polymerase, and an ABI Prism 7500 PCR System. The primers used are listed in Table E1. The cycle threshold (Ct) of each gene transcript was normalized to the mean Ct of β-actin and GAPDH. Fold differences were determined by the 2 - ΔΔ Ct method (2). Standardized IL-25 expression value was generated after -ΔΔCt of IL-25 were centered and scaled as previously E2

described (3). We measured plasma IL-25 by ELISA (NeoBioscience, China). E3

Supplementary References 1. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med 2003; 167: 1360-1368. 2. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: 402-408. 3. Bhakta NR, Solberg OD, Nguyen CP, Nguyen CN, Arron JR, Fahy JV, Woodruff PG. A qpcr-based metric of Th2 airway inflammation in asthma. Clin Transl Allergy 2013; 3: 24. E4

Supplementary Figure Legends Figure E1. Bronchial expression of IL-17RB is increased in subjects with asthma. (A) IL-17RB staining in bronchial biopsies from healthy control subjects (n = 13) and subjects with asthma (n = 27) (original magnification 400). (B) Quantitation of IL-17RB stained cells in the epithelium. (C) Correlation between the numbers of IL-17RB stained cells and IL-25 stained cells in airway epithelium for healthy controls and subjects with asthma. Some subjects were not included in the analyses of IL-17RB staining because bronchial biopsies from those subjects were not adequate for immunohistochemistry due to limitations in the amount of intact tissue seen in the sections. Figure E2. Percentage of IL-25-low and IL-25-high subjects with positive skin prick tests to specific allergens. Figure E3. Bronchial epithelial POSTN transcript levels are increased in subjects with high epithelial IL-25 expression. Levels of transcripts for POSTN in bronchial brushings were determined by quantitative PCR. Values are relative to the median value for healthy controls. Figure E4. MUC5AC and MUC5B proteins in healthy controls and subjects with IL-25 low and IL-25 high asthma. Representative images of immunofluorescent staining for MUC5AC (green), MUC5B (red) and DAPI nuclear staining (blue) in E5

bronchial biopsies (original magnification 200). Figure E5. Sensitivity and specificity of biomarkers for ICS responsiveness. Receiver operating characteristic curve analysis of the sensitivity and specificity of plasma IL-25, blood eosinophil numbers, sputum eosinophil percentage and biopsy eosinophil numbers for ICS responsiveness. Responsive to ICS was defined as > 7.5% improvement in FEV 1 after 8 weeks of ICS treatment. AUC, area under the curve. Figure E6. Plasma IL-25 levels are decreased after ICS treatment in subjects with IL-25-high asthma. Plasma IL-25 levels in subjects with IL-25-low asthma (A) and IL-25-high asthma (B) before and after ICS treatment for 4 weeks. E6

Supplementary Table E1 ALLERGENS USED IN SKIN PRICK TEST Allergen Cockroach Bombyx mori silk Dermatophagoides farinae Dermatophagoides pteronyssinus Cat hair Dog hair Poplar pollen Platanus hispanica pollen Mugwort pollen Ragweed pollen Alternaria Cladosponium Aspergillus Penicillum

Supplementary Table E2. PRIMERS FOR QUANTITATIVE PCR Gene Type Sequence IL-25 Forward GGCCTGTCAGTCAGTGCCCC Reverse CACAGGGGCCAAGCATCTGG IL-33 Forward GTGACGGTGTTGATGGTAAGAT Reverse AGCTCCACAGAGTGTTCCTTG TSLP Forward ATGTTCGCCATGAAAACTAAGGC Reverse GCGACGCCACAATCCTTGTA IL-17RB Forward CAGAGTGGATGCTACAACATGAT Reverse CGGAGTACCCAGCTTACATTCA MUC5AC Forward CAGCACAACCCCTGTTTCAAA Reverse GCGCACAGAGGATGACAGT MUC5B Forward GCCTACGAGGACTTCAACGTC Reverse CCTTGATGACAACACGGGTGA CLCA1 Forward ATGGCTATGAAGGCATTGTCG Reverse TGGCACATTGGGGTCGATTG POSTN Forward GACCGTGTGCTTACACAAATTG Reverse AAGTGACCGTCTCTTCCAAGG SERPINB2 Forward AGCCCAACGATGACTACTTACT Reverse ACCCAAGAGTTGATGTCCTTTCT β-actin Forward GCAAGCAGGACTATGACGAG Reverse CAAATAAAGCCATGCCAATC GAPDH Forward AAGGTGAAGGTCGGAGTCAAC Reverse GGGGTCATTGATGGCAACAATA

Supplementary Table E3. THE PERCENTAGE OF IL-25-LOW AND IL-25-HIGH ASTHMA PREDICTED BY DIFFERENT PLASMA IL-25 CUTOFFS Plasma IL-25 (pg/ml) IL-25-low (%) Plasma IL-25 (pg/ml) IL-25-high (%) 50 11/22 (50.0%) >50 19/21 (90.5%) 55 16/22 (72.7%) >55 17/21 (80.9%) 60 17/22 (77.3%) >60 12/21 (57.1%)

Figure E1

Figure E2

Figure E3

Figure E4

Figure E5

Figure E6