Direct Response Diagnostics

Similar documents
Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Abaxis Piccolo xpress TM

Rapid Laboratories In House Tests

VITROS MicroSlide Assay Summary

NORMAL LABORATORY VALUES FOR CHILDREN

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

HM5. Hematology Analyzer BETTER. ACTUALLY.

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Advanced Hematology Five-Part Differential. Simple Operation

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Controls & Calibrators Clinical Chemistry

BASIC METABOLIC PANEL

Delta Check Calculation Guide

NEW RCPCH REFERENCE RANGES-

10 Essential Blood Tests PART 1

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Tables of Normal Values (As of February 2005)

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

Understanding Blood Tests

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Clinician Blood Panel Results

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Clinician Blood Panel Results

Online catalog

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

Hamilton Regional Laboratory Medicine Program

Inspector's Accreditation Unit Activity Menu

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

BC Biomedical Laboratories Adult Reference Ranges

To be used for the ease of test requisitioning on select patients only; all components may be ordered separately

GRADING CRITERIA for CMS Regulated Analytes

Serodos and Serodos plus

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

Analyte Specimen Demographic Reference Range Units

Specimen Collection Requirements

Specimen Collection Requirements

Multiphasic Blood Analysis

CLINICAL CHEMISTRY REAGENTS. Product Profile

Hamilton Regional Laboratory Medicine Program

Complete Medical History

INFECTION/ INFLAMMATION

Alaska Native Medical Center Anchorage, AK

CTAD as a universal anticoagulant

Clinician Blood Panel Results

TRACEABILITY and UNCERTAINTY

CERTIFICATE OF ACCREDITATION

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

Roche/Hitachi - PreciControl ClinChem Multi 2

ENROLLMENT CONFIRMATION

TRACEABILITY and UNCERTAINTY

General Chemistry Scheme Guide

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Get to know yourself better. Attend our health screening event.

Special issue: Six Sigma metrics Original papers

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

CERTIFICATE OF ACCREDITATION

Types of target values, acceptable ranges

Senior Executive Wellness Profile

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

Fullerton Healthcare Screening Centres

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Setting of quality standards

Point-of-Care Test Products. Article List

CERTIFICATE OF ACCREDITATION

The analytical phase

BS-230. Clinical Chemistry Analyzer

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

Please contact the Client Services Team if you require further information.

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Get to know yourself better. Attend our health screening event.

Laboratory Medicine Standardization Activity in Japan

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018

Uni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Supplementary materials

The Use of Tests in Clinical Biochemistry Interpreting Blood Results. Rowland Reece Principal Clinical Biochemist St. Vincent s University Hospital

COBAS INTEGRA / cobas c C.f.a.s.

Conference. Clinical Chemistry 43: (1997) Oak Ridge

TRACEABILITY and UNCERTAINTY 7

i. Where is the participant seen?

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Transcription:

Direct Response Diagnostics Overview of Point-of-care Systems www.sysmex.nl www.sysmex.be

Introduction Product overview/table of contents In 2003 Sysmex launched the poch-100i. It was the first Sysmex analyser that was made for point-of-care (POC) use. To this day, poch-100i is one of the most used haematology analysers in a POC environment... We are happy to present you an overview of POC products available in the Benelux countries. 4 6 8 10 Haematology Haematology Clinical Chemistry Cardialogy 12 14 16 Clinical Chemistry Clinical Chemistry and Haematology Blood Gas 2 3

XP-300 Automated Haematology Analyser The Sysmex XP-300 was launched in 2008. It is an automated 3-part differential haematology analyser and a great choice for laboratories that need robust, reliable service and highquality diagnostic results. Parameters WBC, RBC, HGB, HCT, MCV, MCH, MCHC, PLT, LYM#, LYM%, MXD#, MXD%, NEUT#, NEUT%, RDW-SD, RDW-CV, PDW, MPV, P-LCR, PCT 4 Whole blood 1 minute ~ 50 µl per test 42.0 (W) x 35.5 (D) x 48.0 (H) cm Performs rapid and accurate analysis of a 17-parameter CBC n Same detection method as Sysmex high-end systems n Non-toxic, biodegradable reagents n 5

poch-100i Automated Haematology Analyser The poch-100i has been used for analysing blood samples for over a decade. This robust analyser has a closed module and is frequently used in hospitals, laboratories and clinics. Parameter WBC, RBC, HGB, HCT, MCV, MCH, MCHC, PLT, LYM#, LYM%, MXD#, MXD%, NEUT#, NEUT%, RDW-SD, RDW-CV, PDW, MPV, P-LCR Whole blood 2.5 minutes 15 µl per test 18.5 (W) x 46.0 (D) x 35.0 (H) cm n Proven technology for accuracy and results n Closed tube patient and QC sampling n Small and compact analyzer ideal for POCT 6 7

Fuji DRI-CHEM NX500 Clinical chemistry Analyser FUJI DRI-CHEM NX500, developed by FUJIFILM, is a dry chemistry system that is particularly flexible due to the test-based parameter selection. The analyser is especially popular in satellite laboratories. Whole blood, Serum or Plasma 1 to 6 minutes ~ 10 µl per test 47.0 (W) x 36.0 (D) x 42.0 (H) cm Parameter Measurement range Measurement time (min.) ALP 14 1 183 U/L 4 AMYL 10 1 200 U/L 5 CHE 5 500 U/L 4.5 CKMB 1 300 U/L 5 CPK 10 2 000 U/L 4 GGT 10 1 200 U/L 5 GOT/AST 10 1 000 U/L 4 GPT/ALT 10 1 000 U/L 4 LAP 10 500 U/L 4 LDH 50 900 U/L 2 LIP 20 1 000 U/L 5 ALB 10 60 g/l 6 BUN 1.79 49.98 mmol/l 4 Ca 1.00 4.00 mmol/l 4 CRE 18 2 122 µmol/l 5 DBIL 2 274 µmol/l 5 GLU 0.6 33.3 mmol/l 6 HDL-C 0.26 2.84 mmol/l 2 IP 0.16 4.84 mmol/l 5 Mg 0.08 2.88 mmol/l 4.5 NH3 7 357 µmol/l 2 TBIL 3 513 µmol/l 6 TCHO 1.29 11.64 mmol/l 6 TCO2 5 40 mmol/l 5 TG 0.11 5.65 mmol/l 4 TP 20 110 g/l 6 UA 30 1 071 µmol/l 4 NA 75 250 mmol/l 1 K 1.0 14.0 mmol/l 1 Cl 50 175 g/l 1 CRP 3 70 µmol/l 5 n Plasma filter to separate the whole blood within 1 minute n Combine your own test panel with single test slides n Dry chemistry 8 Fuji DRI-CHEM NX500 is a registered product of FUJIFILM Corporation www.fujifilm.com 9

PATHFAST A compact immunoanalyser The PATHFAST system combines the accuracy of a fullscale lab analyser with the flexibility of a mobile solution. High precision makes this analyser an adequate satellite of a full-scale lab on a cardiology, intensive care or emergency ward. PATHFAST is also an ideal supplement or back-up system in central labs. Parameter Trop I sensitive, NTproBNP, D-Dimer, hscrp, Myoglobin, HCG, CK-MB mass, Presepsin Whole blood ~ 16 minutes 100 µl 37.5 (W) x 57.0 (D) x 51.0 (H) cm n Superior assay performance n Six results in less than 16 minutes n Improved ease-of-use 10 PATHFAST is a registered product of Mitsubishi Chemical Europe GmbH www.pathfast.eu 11

Piccolo Xpress Clinical chemistry analyser Piccolo Xpress, developed by Abaxis, analyses over 30 parameters across 16 complete panels. The analyser is frequently used in pediatric, stroke, geriatric and neonatalogy wards. Other institutions include rehab centers and nursing homes. Parameter Lipid Panel Lipid Panel Plus Liver Panel Plus General Chemistry 6 General Chemistry 13 AmLyte 13 Comprehensive Metabolic Panel Basic Metabolic Panel Basic Metabolic Panel Plus MetLyte 8 Panel MetLac 12 Panel MetLyte Plus CRP Renal Function Panel Kidney Check Hepatic Function Panel BioChemistry Panel Plus Electrolyte Panel ALB n n n n n n n n Albumin ALP n n n n n Alkaline phosphatase ALT n n n n n n n n Alanin aminotransferase AST n n n n n n n n Aspartate aminotransferase BUN n n n n n n n n n n n n Blood Urea Nitrogen * Ca n n n n n n n n Calcium CK n n n Creatin Kinase Cl n n n n n n n n Chloride CRE n n n n n n n n n n n n Creatinine GFR * n n n n n n n n n n n Glomerular Filtration Rate * CRP n n n C-Reactive Protein DBIL n Direct Bilirubin GGT n n n n Gamma glutamyltransferase GLU n n n n n n n n n n n n Glucose K + n n n n n n n n n Potassium LAC n Lactate LDH n Lactate Dehydrogenase Mg n n Magnesium Na + n n n n n n n n n Sodium PHOS n n Phosphorus AMY n n n n Amylase TBIL n n n n n Total bilirubin tco n n n n n n n n 2 Total carbon dioxide Whole blood, Serum or Plasma 12 minutes per disk ~ 100 µl per test 14.9 (W) x 21.0 (D) x 32.5 (H) cm TP n n n n n Total protein UA n n Uric Acid CHOL n n Total cholesterol CHOL/HDL * n n Total cholesterol/hdl ratio * HDL n n High-Density Lipoprotein LDL * n n Low Density Lipoprotein * TRIG n n Triglycerides n Complete test panels n Minimal handling n Wet chemistry VLDL * n n Very Low Density Lipoprotein * nhdlc * n n non-hdl Colesterol * * Calculated value 12 Piccolo Xpress is a registered product of Abaxis Inc. www.abaxis.com, www.piccoloxpress.com 13

CUBE-S The pocket size laboratory Parameter Field of use Sample material Sample volume In 2016 Eurolyser launched the new CUBE-S. This new version has an automatic haematocrit correction and additional parameters. The CUBE-S can be used in hospitals, satellite laboratories and general practitioners offices. This product is distributed by Sysmex in Belgium only. CRP Inflammation Status Serum or Whole blood 5 µl hscrp Cardiological Risk Serum or Whole blood 20 µl HbA 1c Diabetes Monitoring Whole blood 10 µl Cystatin C Diabetes Monitoring / Renal Diagnostics Serum or Whole blood 20 µl PT (INR) Coagulation Monitoring Whole blood 20 µl D-Dimer Coagulation Monitoring/Thrombosis Diagnostics Plasma 20 µl Ferritin Iron deficiency disorders Serum 50 µl Troponin I Cardiological Risk Serum 50 µl Lipoprotein (a) Cardiological Risk Serum or Plasma 10 µl Hb Iron Deficiency Disorders Whole Blood 20 µl LDL Cholestrol Cardiological Risk Serum or Plasma 10 µl ASO Infection Diagnostics Serum or Whole blood 5 µl µalb Diabetes Monitoring/ Renal Diagnostics Urine 20 µl K+ Potassium Cardiological Risk Serum or Plasma 20 µl Whole blood, Serum or Plasma From 1 minute From 5 µl 16.0 (W) x 14.5 (D) x 13.5 (H) cm n Sample tube with capillary n Maintenance free n Android app-based software 14 Eurolyser CUBE is a registered product of Eurolyser Diagnostica GmbH www.eurolyser.com 15

OPTI CCA-TS2 Portable Blood Gas Analyser The OPTI CCA-TS2 bloodgas analyser is manufactured by OPTImedical, based in Atlanta (US). The analyser is robust, portable and maintenance-free. It is suitable for daily or irregular use. B-60 B E E-CI E-Ca E-Glu E-BUN B-Lac ph X X X X X X X X pco 2 X X X X X X X X* po 2 X X X X X X X X thb X X X X X X X so2 X X X X X X X Na + X X X X X K + X X X X X CI - X CA ++ Glucose BUN(Urea) Lactate X X X X *Pending FDA 510k clearance Whole blood, Serum or Plasma ~ 2 minutes 125 µl, (60 µl for B-60 casette) 36.2 (W) x 23.0 (D) x 12.0 (H) cm n Low risk on pre-analytical errors n Maintenance free n Optional: Battery operated 16 OPTI CCA-TS2 is a registred product of IDEXX laboratories, Inc. www.idexx.com, www.optimedical.com 17

Bibliography XP-300 van Dievoet MA, Louagie H & Ghys T. (2016): Performance evaluation of the Sysmex XP-300 in an oncology setting: evaluation and comparison of hematological parameters with the Sysmex XN-3000. International Journal of Laboratory Hematology. 38(5), 490 496. poch-100i Briggs C, Kunka S, Pennaneach C, Forbes L & Machin SJ. (2002): Performance evaluation of a new compact hematology analyzer, the Sysmex poch-100i. Laboratory hematology: official publication of the International Society for Laboratory Hematology. 9(4), 225 233. Whisler S & Dahlgren C. (2004): Performance evaluation of the Sysmex poch-100i automated hematology analyzer. Laboratory hematology: official publication of the International Society for Laboratory Hematology. 11(2), 107 117. Fuji DRI-CHEM NX500 Yang JH, Kim JH, Lee JY, Choi KY, Lee SW, Lee YS,... & Kwon SY. (2014): Evaluation of Point-of-Care Testing Devices for Pre-donation Alanine Aminotransferase Test. Korean Journal of Blood Transfusion. 25(2), 105 112. Piccolo Xpress Park H, Ko DH, Kim JQ & Song SH. (2009): Performance evaluation of the Piccolo xpress Point-of-care Chemistry Analyzer. The Korean journal of laboratory medicine. 29(5), 430 438. Owen WE, Caron JE & Genzen JR. (2015): Liver function testing on the Abaxis Piccolo Xpress: Use in Ebola virus disease protocols. Clinica Chimica Acta. 446, 119 127.6. Simpson P, Jolly L, Tirimacco R, Gill J & Tideman P. (2010): Evaluation of the lipid panel on the Abaxis Piccolo Xpress to determine its potential as a point-of-care instrument in a nonlaboratory setting. Point of Care. 9(1), 32 35. CUBE-S Brouwer N & van Pelt J. (2015): Validation and evaluation of eight commercially available Point of Care CRP methods. Clinica Chimica Acta. 439, 195 201. OPTI CCA-TS2 Schlebusch H, Paffenholz I, Zerback R & Leinberger R. (2001): Analytical performance of a portable critical care blood gas analyzer. Clinica chimica acta. 307(1), 107 112. PATHFAST Kurihara T, Yanagida A, Yokoi H, Koyata A, Matsuya T, Ogawa J,... & Miyamoto D. (2008): Evaluation of cardiac assays on a benchtop chemiluminescent enzyme immunoassay analyzer, PATHFAST. Analytical biochemistry. 375(1), 144 146. 18 19

Design and specifications may be subject to change due to further product development. Changes are confirmed by their appearance on a newer document and verification according to its date of issue. Copyright 2017 Sysmex Europe GmbH/Sysmex Nederland BV Distributor The Netherlands: Sysmex Nederland B.V. Ecustraat 11, 4879 NP Etten-Leur, The Netherlands Phone +31 76 5086000 Fax +31 76 5086086 info@sysmex.nl www.sysmex.nl Distributor Belgium: Sysmex Belgium N.V. Park Rozendal, Building A, Terhulpsesteenweg 6a, 1560 Hoeilaart, Belgium Phone +32 2 7697474 Fax +32 2 7697499 info@sysmex.be www.sysmex.be Distributor: Sysmex Europe GmbH Bornbarch 1, 22848 Norderstedt, Germany Phone +49 40 52726-0 Fax +49 40 52726-100 drd@sysmex-europe.com www.sysmex-europe.com You will find your local Sysmex representative s address under www.sysmex-europe.com/contacts DRD.EN.C.02/17