NOTE: This table will be discontinued after this lot.

Similar documents
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

HM5. Hematology Analyzer BETTER. ACTUALLY.

BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S.

Advanced Hematology Five-Part Differential. Simple Operation

Brief Communication Diagnostic Hematology

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

LabDriver Audit Trail Example

3. Blood Cell Histograms:

INFECTION/ INFLAMMATION

e-figure 1. The design of the study.

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Differential Blood Smear H3

Differential Blood Smear H3

Icd code for cbc with differential/ platelet

How useful are complete blood count and reticulocyte reports to clinicians in Addis Ababa hospitals, Ethiopia?

Differential Blood Smear H3

SediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Performance Evaluation of the Plateletworks in the Measurement of Blood Cell Counts as compared to the Beckman Coulter Unicel DXH 800

Evaluation of haematology analyzer CELL-DYN 3700 SL

Mpv blood test results explained

2013/11/29 Version 2

Hematological Effects of Cadmium in Hybrid Isa brown

Continuing Education Questions

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

NORMAL LABORATORY VALUES FOR CHILDREN

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice

A Study on the Relationship between CBC and EEG for Epilepsy Patients

Changes to CBC Reference Ranges

Clinical use of flow cytometry

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

ACCREDITATION DOCUMENT

Hematological effects of mercury in hybrid birds Isa brown

Date Time By Code Description Qty (Variance) Photo

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

CELL-DYN 3700 Strength in Technology, Proven Reliability

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

Date By Code Description Qty (Variance) Photo

10 Essential Blood Tests PART 1

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Control Data of Rat

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

COMPANY OR UNIVERSITY

CASE-BASED SMALL GROUP DISCUSSION

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

V.N. Karazin Kharkiv National University

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

CASE-BASED SMALL GROUP DISCUSSION

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

Performance evaluation of Celltac G: a new automated hematology analyzer

California Association for Medical Laboratory Technology

Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)

Biological Variations of Hematologic Parameters Determined by UniCel DxH 800 Hematology Analyzer

Hematopathology Case Study

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Kathleen Finnegan MS MT(ASCP)SHCM

Step 2. Common Blood Tests, and the Coulter Counter Readout

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Complete Blood Count (CBC)

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

6/6/2016 pg. 1 of 24

Case Study. Accidental Diagnosis of Multiple Myeloma in a 44-Year-Old White Woman due to Erroneous Results via Chemical Analyzers.

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

The Complete Blood Count

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

A nationwide multicentre study in Turkey for establishing reference intervals of haematological parameters with novel use of a panel of whole blood

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Laboratory for diagnosis of THALASSEMIA

* Final Report * ED Triage Entered On: 01/16/2014 8:45 EST Performed On: 01/16/2014 8:42 EST by

Now what do you have to learn?

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

Meet Moxie. Moxie looks great. Looks can be deceiving. Moxie is visible through die-cut.

Effect of the addition of the antioxidant taurine on the complete blood count of whole blood stored at room temperature and at 4 C for up to 7 days

SAFETY ASSESSMENT OF L-DOPA AND HYOSCINE HYDROBROMIDE IN COMBINATION: ACUTE AND SUB-ACUTE ORAL TOXICITY STUDIES

Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital

Haematology Comparability Document

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

Hepatitis A virus (HAV)

CASE-BASED SMALL GROUP DISCUSSION

MHD II Session 3 STUDENT COPY

Direct Response Diagnostics

Paper ID: ART

Clinician Blood Panel Results

Influence of deep-freezing on the autofluorescent properties of human plasma proteins

Clinician Blood Panel Results

SMALL GROUP DISCUSSION

Rapid Laboratories In House Tests

Transcription:

AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6 NE% % 54.0 ± 12.0 NE# 10 3 /µl 2.1 ± 0.5 NOTE: This table will be discontinued after this lot. LY% % 32.0 ± 10.0 LY# 10 3 /µl 1.3 ± 0.5 MO% % 5.0 ± 5.0 MO# 10 3 /µl 0.2 ± 0.2 EO% % 8.0 ± 8.0 EO# 10 3 /µl 0.3 ± 0.3 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 RBC 10 6 /µl 2.53 ± 0.12 HGB g/dl 6.7 ± 0.4 HGB g/l 67 ± 4 HGB mmol/l 4.2 ± 0.3 HCT % 21.5 ± 1.5 HCT L/L 0.215 ± 0.015 MCV fl 85.0 ± 5.0 MCH pg 26.5 ± 1.8 MCH fmol 1.64 ± 0.11 MCHC g/dl 31.2 ± 2.4 MCHC g/l 312 ± 24 MCHC mmol/l 19.3 ± 2.3 RDW % 16.0 ± 5.0 PLT 10 3 /µl 80 ± 20 MPV fl 8.7 ± 2.0 * PCT % 0.070 ± 0.030 * PCT ml/l 0.7 ± 0.3 * PDW 16.5 ± 3.0 AS037-011 Rev. 11/14

AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 2 ++ Lot No.: Exp. Date: LOT 882086 Parameter Mean Range WBC 10 3 /µl 9.9 ± 1.5 NE% % 60.0 ± 12.0 NE# 10 3 /µl 5.9 ± 1.2 NOTE: This table will be discontinued after this lot. LY% % 25.0 ± 10.0 LY# 10 3 /µl 2.5 ± 1.1 MO% % 6.0 ± 6.0 MO# 10 3 /µl 0.6 ± 0.6 EO% % 8.0 ± 8.0 EO# 10 3 /µl 0.8 ± 0.8 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 RBC 10 6 /µl 4.16 ± 0.18 HGB g/dl 12.1 ± 0.5 HGB g/l 121 ± 5 HGB mmol/l 7.5 ± 0.3 HCT % 38.9 ± 2.0 HCT L/L 0.389 ± 0.020 MCV fl 93.5 ± 5.0 MCH pg 29.1 ± 1.8 MCH fmol 1.80 ± 0.12 MCHC g/dl 31.1 ± 2.4 MCHC g/l 311 ± 24 MCHC mmol/l 19.3 ± 1.8 RDW % 15.0 ± 5.0 PLT 10 3 /µl 255 ± 50 MPV fl 8.6 ± 2.0 * PCT % 0.215 ± 0.050 * PCT ml/l 2.2 ± 0.5 * PDW 16.3 ± 3.0 AS037-011 Rev. 11/14

AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 3 +++ Lot No.: Exp. Date: LOT 863086 Parameter Mean Range WBC 10 3 /µl 21.8 ± 2.8 NE% % 68.0 ± 12.0 NE# 10 3 /µl 14.9 ± 2.7 NOTE: This table will be discontinued after this lot. LY% % 17.5 ± 10.0 LY# 10 3 /µl 3.8 ± 2.2 MO% % 8.0 ± 8.0 MO# 10 3 /µl 1.7 ± 1.7 EO% % 5.5 ± 5.5 EO# 10 3 /µl 1.2 ± 1.2 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.2 ± 0.2 RBC 10 6 /µl 5.45 ± 0.24 HGB g/dl 16.8 ± 0.8 HGB g/l 168 ± 8 HGB mmol/l 10.4 ± 0.5 HCT % 56.4 ± 2.8 HCT L/L 0.564 ± 0.028 MCV fl 103.5 ± 5.0 MCH pg 30.8 ± 1.8 MCH fmol 1.91 ± 0.16 MCHC g/dl 29.8 ± 2.4 MCHC g/l 298 ± 24 MCHC mmol/l 18.5 ± 1.8 RDW % 14.5 ± 5.0 PLT 10 3 /µl 445 ± 70 MPV fl 8.7 ± 2.0 * PCT % 0.380 ± 0.080 * PCT ml/l 3.8 ± 0.8 * PDW 16.2 ± 3.0 AS037-011 Rev. 11/14

ASSAY VALUES AND EXPECTED RANGES + Beckman Coulter UniCel DxH TM 800/600 QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT 128710860 Lot No.: LOT 138820860 Lot No.: LOT 148630860 Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 4.0 ± 0.6 10.4 ± 1.5 22.4 ± 2.8 NE% % 66.0 ± 15.0 65.0 ± 15.0 66.0 ± 15.0 NE# 10 3 /µl 2.6 ± 0.6 6.7 ± 1.6 14.8 ± 3.4 LY% % 18.0 ± 13.0 14.0 ± 11.0 14.0 ± 10.0 LY# 10 3 /µl 0.7 ± 0.5 1.5 ± 1.2 3.1 ± 2.2 MO% % 4.0 ± 4.0 9.0 ± 9.0 12.0 ± 12.0 MO# 10 3 /µl 0.2 ± 0.2 0.9 ± 0.9 2.7 ± 2.7 EO% % 11.0 ± 11.0 10.5 ± 10.5 6.5 ± 6.5 EO# 10 3 /µl 0.4 ± 0.4 1.1 ± 1.1 1.5 ± 1.5 BA% % 1.0 ± 1.0 1.5 ± 1.5 1.5 ± 1.5 BA# 10 3 /µl 0.1 ± 0.1 0.2 ± 0.2 0.3 ± 0.3 RBC 10 6 /µl 2.53 ± 0.12 4.16 ± 0.18 5.45 ± 0.24 HGB g/dl 6.7 ± 0.4 12.1 ± 0.5 16.8 ± 0.8 HGB g/l 67 ± 4 121 ± 5 168 ± 8 HGB mmol/l 4.2 ± 0.3 7.5 ± 0.3 10.4 ± 0.5 HCT % 22.1 ± 1.5 40.1 ± 2.0 58.0 ± 2.8 HCT L/L 0.221 ± 0.015 0.401 ± 0.020 0.580 ± 0.028 MCV fl 87.5 ± 5.0 96.5 ± 5.0 106.5 ± 5.0 MCH pg 26.5 ± 1.8 29.1 ± 1.8 30.8 ± 1.8 MCH fmol 1.64 ± 0.11 1.80 ± 0.12 1.91 ± 0.16 MCHC g/dl 30.3 ± 2.4 30.1 ± 2.4 28.9 ± 2.4 MCHC g/l 303 ± 24 301 ± 24 289 ± 24 MCHC mmol/l 18.8 ± 2.3 18.7 ± 1.8 17.9 ± 1.8 RDW % 16.0 ± 5.0 15.0 ± 5.0 14.5 ± 5.0 RDW-SD fl 50.5 ± 10.0 52.5 ± 10.0 56.5 ± 10.0 PLT 10 3 /µl 80 ± 20 255 ± 50 445 ± 70 MPV fl 8.7 ± 2.0 8.6 ± 2.0 8.7 ± 2.0 * PCT % 0.070 ± 0.030 0.215 ± 0.050 0.380 ± 0.080 * PCT ml/l 0.7 ± 0.3 2.2 ± 0.5 3.8 ± 0.8 * PDW 16.5 ± 3.0 16.3 ± 3.0 16.2 ± 3.0

NOTE: This table will be discontinued after this lot. ASSAY VALUES AND EXPECTED RANGES ++ Beckman Coulter GEN S TM QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT 871086 Lot No.: LOT 882086 Lot No.: LOT 863086 Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± 0.6 9.9 ± 1.5 21.3 ± 2.8 NE% % 55.0 ± 12.0 60.5 ± 12.0 69.0 ± 12.0 NE# 10 3 /µl 2.1 ± 0.5 6.0 ± 1.2 14.7 ± 2.6 LY% % 34.0 ± 10.0 28.0 ± 10.0 21.0 ± 10.0 LY# 10 3 /µl 1.3 ± 0.4 2.8 ± 1.1 4.5 ± 2.2 MO% % 2.0 ± 2.0 3.0 ± 3.0 4.0 ± 4.0 MO# 10 3 /µl 0.1 ± 0.1 0.3 ± 0.3 0.8 ± 0.8 EO% % 8.0 ± 8.0 7.5 ± 7.5 5.0 ± 5.0 EO# 10 3 /µl 0.3 ± 0.3 0.7 ± 0.7 1.1 ± 1.1 BA% % 1.0 ± 1.0 1.0 ± 1.0 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 0.1 ± 0.1 0.2 ± 0.2 RBC 10 6 /µl 2.53 ± 0.12 4.16 ± 0.18 5.45 ± 0.24 HGB g/dl 6.7 ± 0.4 12.1 ± 0.5 16.8 ± 0.8 HGB g/l 67 ± 4 121 ± 5 168 ± 8 HGB mmol/l 4.2 ± 0.3 7.5 ± 0.3 10.4 ± 0.5 HCT % 21.5 ± 1.5 38.9 ± 2.0 56.4 ± 2.8 HCT L/L 0.215 ± 0.015 0.389 ± 0.020 0.564 ± 0.028 MCV fl 85.0 ± 5.0 93.5 ± 5.0 103.5 ± 5.0 MCH pg 26.5 ± 1.8 29.1 ± 1.8 30.8 ± 1.8 MCH fmol 1.64 ± 0.11 1.80 ± 0.12 1.91 ± 0.16 MCHC g/dl 31.2 ± 2.4 31.1 ± 2.4 29.8 ± 2.4 MCHC g/l 312 ± 24 311 ± 24 298 ± 24 MCHC mmol/l 19.3 ± 2.3 19.3 ± 1.8 18.5 ± 1.8 RDW % 16.0 ± 5.0 15.0 ± 5.0 14.5 ± 5.0 PLT 10 3 /µl 80 ± 20 255 ± 50 445 ± 70 MPV fl 8.7 ± 2.0 8.6 ± 2.0 8.7 ± 2.0 * PCT % 0.070 ± 0.030 0.215 ± 0.050 0.380 ± 0.080 * PCT ml/l 0.7 ± 0.3 2.2 ± 0.5 3.8 ± 0.8 * PDW 16.5 ± 3.0 16.3 ± 3.0 16.2 ± 3.0

ASSAY VALUES AND EXPECTED RANGES +++ Beckman Coulter LH 700 Series QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT 871086 Lot No.: LOT 882086 Lot No.: LOT 863086 Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± 0.6 9.9 ± 1.5 21.3 ± 2.8 NE% % 54.5 ± 12.0 60.5 ± 12.0 69.0 ± 12.0 NE# 10 3 /µl 2.1 ± 0.5 6.0 ± 1.2 14.7 ± 2.6 LY% % 32.0 ± 10.0 25.0 ± 10.0 17.5 ± 10.0 LY# 10 3 /µl 1.2 ± 0.4 2.5 ± 1.1 3.7 ± 2.2 MO% % 5.0 ± 5.0 6.0 ± 6.0 7.5 ± 7.5 MO# 10 3 /µl 0.2 ± 0.2 0.6 ± 0.6 1.6 ± 1.6 EO% % 7.5 ± 7.5 7.5 ± 7.5 5.0 ± 5.0 EO# 10 3 /µl 0.3 ± 0.3 0.7 ± 0.7 1.1 ± 1.1 BA% % 1.0 ± 1.0 1.0 ± 1.0 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 0.1 ± 0.1 0.2 ± 0.2 RBC 10 6 /µl 2.53 ± 0.12 4.16 ± 0.18 5.45 ± 0.24 HGB g/dl 6.7 ± 0.4 12.1 ± 0.5 16.8 ± 0.8 HGB g/l 67 ± 4 121 ± 5 168 ± 8 HGB mmol/l 4.2 ± 0.3 7.5 ± 0.3 10.4 ± 0.5 HCT % 21.5 ± 1.5 38.9 ± 2.0 56.4 ± 2.8 HCT L/L 0.215 ± 0.015 0.389 ± 0.020 0.564 ± 0.028 MCV fl 85.0 ± 5.0 93.5 ± 5.0 103.5 ± 5.0 MCH pg 26.5 ± 1.8 29.1 ± 1.8 30.8 ± 1.8 MCH fmol 1.64 ± 0.11 1.80 ± 0.12 1.91 ± 0.16 MCHC g/dl 31.2 ± 2.4 31.1 ± 2.4 29.8 ± 2.4 MCHC g/l 312 ± 24 311 ± 24 298 ± 24 MCHC mmol/l 19.3 ± 2.3 19.3 ± 1.8 18.5 ± 1.8 RDW % 16.0 ± 5.0 15.0 ± 5.0 14.5 ± 5.0 * RDW-SD fl 50.5 ± 10.0 52.5 ± 10.0 56.5 ± 10.0 PLT 10 3 /µl 80 ± 20 255 ± 50 445 ± 70 MPV fl 8.7 ± 2.0 8.6 ± 2.0 8.7 ± 2.0 ** PCT % 0.070 ± 0.030 0.215 ± 0.050 0.380 ± 0.080 ** PCT ml/l 0.7 ± 0.3 2.2 ± 0.5 3.8 ± 0.8 ** PDW 16.5 ± 3.0 16.3 ± 3.0 16.2 ± 3.0 * For Coulter LH 780 Only *

ASSAY VALUES AND EXPECTED RANGES ++++ Beckman Coulter LH 500 QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT 871086 Lot No.: LOT 882086 Lot No.: LOT 863086 Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± 0.6 9.9 ± 1.5 21.3 ± 2.8 NE% % 49.5 ± 12.0 55.0 ± 12.0 64.0 ± 12.0 NE# 10 3 /µl 1.9 ± 0.5 5.5 ± 1.3 13.7 ± 2.6 LY% % 35.5 ± 14.0 26.5 ± 10.0 17.5 ± 10.0 LY# 10 3 /µl 1.4 ± 0.6 2.6 ± 1.0 3.7 ± 2.2 MO% % 4.0 ± 4.0 7.5 ± 7.5 10.0 ± 10.0 MO# 10 3 /µl 0.2 ± 0.2 0.7 ± 0.7 2.1 ± 2.1 EO% % 8.0 ± 8.0 8.0 ± 8.0 5.5 ± 5.5 EO# 10 3 /µl 0.3 ± 0.3 0.8 ± 0.8 1.2 ± 1.2 BA% % 3.0 ± 3.0 3.0 ± 3.0 3.0 ± 3.0 BA# 10 3 /µl 0.1 ± 0.1 0.3 ± 0.3 0.6 ± 0.6 RBC 10 6 /µl 2.53 ± 0.12 4.16 ± 0.18 5.45 ± 0.24 HGB g/dl 6.7 ± 0.4 12.1 ± 0.5 16.8 ± 0.8 HGB g/l 67 ± 4 121 ± 5 168 ± 8 HGB mmol/l 4.2 ± 0.3 7.5 ± 0.3 10.4 ± 0.5 HCT % 21.5 ± 1.5 38.9 ± 2.0 56.4 ± 2.8 HCT L/L 0.215 ± 0.015 0.389 ± 0.020 0.564 ± 0.028 MCV fl 85.0 ± 5.0 93.5 ± 5.0 103.5 ± 5.0 MCH pg 26.5 ± 1.8 29.1 ± 1.8 30.8 ± 1.8 MCH fmol 1.64 ± 0.11 1.80 ± 0.12 1.91 ± 0.16 MCHC g/dl 31.2 ± 2.4 31.1 ± 2.4 29.8 ± 2.4 MCHC g/l 312 ± 24 311 ± 24 298 ± 24 MCHC mmol/l 19.3 ± 2.3 19.3 ± 1.8 18.5 ± 1.8 RDW % 16.0 ± 5.0 15.0 ± 5.0 14.5 ± 5.0 PLT 10 3 /µl 80 ± 20 255 ± 50 445 ± 70 MPV fl 8.7 ± 2.0 8.6 ± 2.0 8.7 ± 2.0 * PCT % 0.070 ± 0.030 0.215 ± 0.050 0.380 ± 0.080 * PCT ml/l 0.7 ± 0.3 2.2 ± 0.5 3.8 ± 0.8 * PDW 16.5 ± 3.0 16.3 ± 3.0 16.2 ± 3.0

LOT DxH 800 Only 871086 12 871086 0 882086 13 882086 0 863086 14 863086 0 +++++ Beckman Coulter UniCel DxH 800/600 Beckman Coulter LH 750 Series Beckman Coulter LH 780 Series Beckman Coulter LH 500

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback