DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos

Epigenetics ISSN: 1559-2294 (Print) 1559-2308 (Online) Journal homepage: http://www.tandfonline.com/loi/kepi20 DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos Azizollah Bakhtari & Pablo J Ross To cite this article: Azizollah Bakhtari & Pablo J Ross (2014) DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos, Epigenetics, 9:9, 1271-1279, DOI: 10.4161/epi.32087 To link to this article: https://doi.org/10.4161/epi.32087 View supplementary material Published online: 01 Aug 2014. Submit your article to this journal Article views: 444 View related articles View Crossmark data Citing articles: 17 View citing articles Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalinformation?journalcode=kepi20 Download by: [37.44.203.253] Date: 28 November 2017, At: 12:19

Research Paper Epigenetics 9:9, 1271 1279; September 2014; 2014 Landes Bioscience Research Paper DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos Azizollah Bakhtari 1,2 and Pablo J Ross 1, * 1 Department of Animal Science; University of California; Davis, CA Usa; 2 Department of Animal Sciences; College of Agriculture; Isfahan University of Technology; Isfahan, Iran Downloaded by [37.44.203.253] at 12:19 28 November 2017 Keywords: DPPA3, knockdown, 5-hydroxymethylcytosine, epigenetic, TET, preimplantation, reprogramming, zygote Abbreviations: DPPA3, developmental pluripotency-associated protein 3; 5mC, 5-methylcytosine; 5hmC, 5-hydroxymethylcytosine; TET, ten-eleven translocation; IVM, in vitro maturation; IVF, in vitro fertilization; PA, parthenogenetic activation Dppa3 has been described in mice as an important maternal factor contributed by the oocyte that participates in protecting the maternal genome from oxidation of methylated cytosines (5mC) to hydroxymethylated cytosines (5hmC). Dppa3 is also required for normal mouse preimplantation development. This gene is poorly conserved across mammalian species, with less than 32% of protein sequence shared between mouse, cow and human. RNA-seq analysis of bovine oocytes and preimplantation embryos revealed that DPPA3 transcripts are some of the most highly abundant mrnas in the oocyte, and their levels gradually decrease toward the time of embryonic genome activation (EGA). Knockdown of DPPA3 by injection of sirna in germinal vesicle (GV) stage oocytes was used to assess its role in epigenetic remodeling and embryo development. DPPA3 knockdown resulted in increased intensity of 5hmC staining in the maternal pronucleus (PN), demonstrating a role for this factor in the asymmetric remodeling of the maternal and paternal PN in bovine zygotes. Also, DPPA3 knockdown decreased the developmental competence of parthenogenetic and in vitro fertilized embryos. Finally, DPPA3 knockdown embryos that reached the blastocyst stage had significantly fewer ICM cells as compared with control embryos. We conclude that DPPA3 is a maternal factor important for correct epigenetic remodeling and normal embryonic development in cattle, indicating that the role of DPPA3 during early development is conserved between species. Introduction Maternal transcripts and proteins supplied by the oocyte at fertilization have a crucial role in the successful development of the early embryo. 1 Some of these factors, among other functions, are involved in the active remodeling of gametic chromatin that occurs during the first stages of development and leads to the activation of the embryonic genome and acquisition of pluripotency. DPPA3, also called PGC7 and STELLA, is one such maternal factor that has been shown to play an important role during early embryonic development of mice. 1-3 DPPA3 was initially identified as a highly expressed gene in primordial germ cells and determined to be a maternal effect gene because its depletion in oocytes could not be rescued by fertilization with wild-type sperm. 4,5 DPPA3 was shown to be necessary for protecting the maternal genome from active DNA demethylation that occurs soon after fertilization. In most mammalian zygotes, the 5-methylcytosine (5mC) content of the paternal chromosomes is actively reduced before the first cell division while the maternal pronucleus (PN) maintains its 5mC status during the same period of time. Recently, the active reduction of 5mC levels was shown to occur because of oxidation of 5mC to 5-hydroxymethylcytosine (5hmC). The conversion of 5mC to 5hmC is catalyzed by ten-11 translocation (TET) oncogene family proteins. 6 All mammalian homologs of TET1, TET2, and TET3 contain a dioxygenase motif with both Fe 2+ and α-ketoglutarate binding and have similar catalytic activities. 7 In the mouse, TET3 is highly expressed in oocytes and zygotes while TET1 and TET2 are not expressed until later in development. In TET3-deficient mouse zygotes, conversion of 5mC to 5hmC in the paternal genome fails and levels of 5mC remain constant. 8 DPPA3 protects 5mC from TET3-mediated conversion to 5hmC by binding to parental chromatin containing dimethylated histone H3 lysine 9 (H3K9me2), which is abundant in the maternal PN and has been observed in the paternally imprinted genes of the mature sperm. 9 In cattle, two variants of DPPA3 mrna differing in their 5 UTR have been identified. One variant was detected in the testis, ovary and oocyte, while the other was oocyte specific. 2 *Correspondence to: Pablo J Ross; Email: pross@ucdavis.edu Submitted: 04/22/2014; Revised: 07/14/2014; Accepted: 07/21/2014; Published Online: 08/01/2014 http://dx.doi.org/10.4161/epi.32087 www.landesbioscience.com Epigenetics 1271

Figure 1. Transcript abundance for DPPA3 and TET genes in bovine oocytes and preimplantation embryos. RPKM: reads per kilobase of gene model per million mapped reads. MII: metaphase II oocytes; 2-C: 2-cell embryos; 8-C: 8-cell embryos; 8-C+Aman: 8-cell embryos developed under the presence of the transcriptional inhibitor α-amanitin, Bl: blastocysts. Figure 2. Efficient knockdown of DPPA3 mrna levels in MII oocytes by sirna injection into GV oocytes. Levels of DPPA3 and TET2 mrna in control and DPPA3 sirna-injected oocytes 24 h after injection. a,b Columns with different letters indicate significant differences (P < 0.0001). DPPA3 codes for a small protein (150, 169 and 163 amino acids in mice, human, and cattle, respectively). 2,3 In mice, the C-terminal tail is required to inhibit TET activity, while the N-terminus is necessary for recognizing H3K9me2. 9 Interestingly, DPPA3 is poorly conserved across species, with only 32% protein identity between human and mouse and 28% between human and cow. 2,3 Given the importance of this gene for early mouse development its poor conservation across species, we evaluated its expression and role during bovine preimplantation development. Results Expression of DPPA3 and TET genes in bovine oocytes and preimplantation embryos Analysis of RNA-seq data produced in our laboratory indicated that DPPA3 is one of the most highly expressed genes in bovine meiosis II (MII) oocytes, ranking among the top 10 most highly expressed genes. High levels of DDPA3 transcript abundance were maintained in 2-cell embryos and decreased toward the 8-cell stage, becoming lower at the blastocyst stage (Fig. 1; Fig. S1). In α-amanitin treated 8-cell embryos (a treatment that prevents active transcription) the relative abundance of DPPA3 mrna increased compared with MII oocytes and 2-cell embryos and was significantly higher than the levels observed in untreated-8-cell embryos (Fig. 1). This data indicates that DPPA3 mrna is provided by the oocyte in large amounts and that maternal mrnas persist until at least the 8-cell stage. Expression of TET methylcytosine dioxygenase gene family members was also analyzed from the RNA-seq data (Fig. 1; Figs. S2 4). TET3 was expressed at higher levels in MII oocytes and cleavage stage embryos when compared with blastocysts. Also, TET3 expression at the 8-cell stage was not blocked by α-amanitin treatment. TET2 followed an expression pattern similar to TET3, but with overall higher levels of expression. TET1 was detected in 8-cell embryos and its expression was blocked by α-amanitin, indicating expression from the embryonic genome. Also, TET1 was the predominant TET gene expressed at the blastocyst stage. Downregulation of DPPA3 mrna levels by sirna injection in bovine GV oocytes An RNAi approach was implemented to decrease the levels of DPPA3 mrna in bovine MII oocytes to study the transcript s function during preimplantation development. sirna was injected in cumulus-enclosed bovine GV oocytes and the levels of DPPA3 analyzed by real-time qpcr after 24 h of in vitro maturation. Control sirna-injected and non-injected oocytes were also analyzed. The levels of DPPA3 mrna were reduced by more than 90% in DPPA3 sirna-injected oocytes compared with non-injected and control sirna-injected oocytes (P < 0.0001; Figure 2). On the other hand, TET2 mrna levels were not affected by DPPA3 sirna injection (Fig. 2). Cytosine methylation and hydroxymethylation in DPPA3 knockdown zygotes The effect of DPPA3 knockdown on epigenetic reprogramming in the late PN stage (22 h after insemination) was evaluated by immunofluorescence staining for 5mC and 5hmC (Fig. 3A). In the non-injected and control-sirna groups, asymmetric staining of the pronuclei was observed. One of the pronuclei showed low staining intensity against 5mC and high staining intensity against 5hmC, while the other pronucleus had the opposite pattern. This is similar to what is observed in mouse PN5 stage, where the female PN stains high for 5mC and low for 5hmC, and the reverse is observed in the male PN (Fig. 3A). Quantification of 5mC and 5hmC fluorescence intensity indicated that the difference between pronuclei within the same embryo (intensity of paternal PN subtracted from intensity of maternal PN) was similar across groups for 5mC, but was significantly decreased in the DPPA3 sirna group in comparison to controls (P < 0.05, Fig. 3B). 1272 Epigenetics Volume 9 Issue 9

Differences in the levels of 5mC between paternal and maternal PN were observed for all treatments (P < 0.05; Fig. 4). However, while in control treatment the levels of 5hmC were significantly different between the maternal and paternal PN (P < 0.001), they were similar in the DPPA3 sirna group (Fig. 4). Spearman s nonparametric correlation between 5mC and 5hmC for non-injected and control sirna-injected groups was -0.712 and -0.726, respectively (P < 0.01). In the DPPA3 sirna-injected embryos, correlation between 5mC and 5hmC was low and not significant. Effect of DPPA3 knockdown on embryo development and quality The developmental potential of DPPA3 sirna-injected oocytes was evaluated by parthenogenetic activation (PA) and in vitro fertilization (IVF) of MII oocytes and culture to the blastocyst stage. As shown in Figures 5A and B, the rate of embryo cleavage in the DPPA3-siRNA group was significantly lower than that of control groups, with 81.5 ± 3.5%, 80.9 ± 2.5% and 50.1 ± 11.0% of oocytes cleaved after PA (P < 0.05), and 86.6 ± 1.4%, 84.7 ± 2.6% and 64.4 ± 4.6% after IVF (P < 0.001) in the noninjected, control sirna-injected and DPPA3-siRNA groups, respectively. The proportion of activated oocytes that developed to the blastocyst stage was significantly lower (P < 0.0001) in the DPPA3-siRNA group (8.7 ± 3.4%) compared with non-injected and control-sirna injected groups (38.1 ± 2.2% and 30.4 ± 2.5%, respectively; Fig. 5A). Also, the proportion of cleaved oocytes that reached the blastocyst stage was lower for DPPA3 knockdown oocytes than for controls. Similarly, the blastocyst rate after IVF was lower (P < 0.001) in the DPPA3-siRNA group (15.6 ± 3.7%) compared with control groups (32.8 ± 2.3%, 28.7 ± 1.0% for non-injected and control-sirna injected groups, respectively; Fig. 5B). To ascertain the quality of embryos that developed to blastocysts we determined the number of lineage-specific cells in blastocysts from each experimental group by immunostaining against SOX2 and CDX2, as markers of inner cell mass (ICM) and trophectoderm (TE) cells, respectively (Fig. 6A). Results indicated that embryos produced from DPPA3 sirna-injected oocytes had fewer ICM cells than non-injected controls (41.9 ± 4.0 vs. 24.2 ± 4.8, P < 0.05; Fig. 6B). On the other hand, the TE and total cell numbers were similar among treatment groups (Fig. 6B). Figure 3. DPPA3 knockdown in bovine oocytes alters the pattern of 5hmC staining in late PN stage embryos. (A) Representative immunofluorescence images of late PN stage embryos (22 h after in vitro insemination in bovine and PN5 stage in mouse). Scale bar = 50 μm. (B) Difference in fluorescence intensity between maternal and paternal PN within individual PN stage embryos (average intensity of paternal PN was subtracted from average intensity of maternal PN). a,b : Different letters indicate significant differences (P < 0.05). Discussion This study reveals an important role for DDPA3 in bovine embryo genome reprogramming and developmental potential. In spite of the low similarity of the DPPA3 protein sequence across species, 2,3 we found similar functions in the bovine early embryo to what has been reported in mice. Expression of DPPA3 was high in bovine oocytes, representing one of the most abundant protein coding gene transcripts. Similar findings have been reported in human and mouse studies. 4,10 Also, the RNA-seq data indicated that both transcript variants reported for cattle DPPA3 were expressed in oocytes and early embryos (Fig. S1), as previously detected by transcript-specific RT-PCR. 2 The pattern of DPPA3 expression during preimplantation development is consistent with that of a maternal effect gene, with high levels in oocytes and 2-cell embryos that decrease toward EGA (8-cell stage). Furthermore, the levels of DPPA3 transcripts observed at the 8-cell stage were not diminished by transcriptional inhibition, demonstrating the maternal origin of the mrna present at this stage. On the contrary, α-amanitin treatment resulted in www.landesbioscience.com Epigenetics 1273

Figure 4. DPPA3 knockdown in bovine oocytes results in increased 5hmC in the female pronucleus. Average fluorescence intensity of 5mC and 5hmC immunostaining at paternal and maternal PN in zygotes derived from control and DPPA3 sirna-injected oocytes. a,b : Different letters indicate significant differences (P < 0.05). Figure 5. DPPA3 knockdown reduced oocyte developmental competence after parthenogenetic activation or in vitro fertilization. In vitro developmental rates of parthenogenetic (A) and IVF-derived embryos (B) produced from control and DPPA3 sirna-injected oocytes. increased DPPA3 transcript abundance suggesting that degradation of DPPA3 mrna at EGA may be transcription dependent. The role of DPPA3 as a maternal effect gene was confirmed by the reduction in embryo developmental rates when DPPA3 was knocked down in GV oocytes. By the blastocyst stage, levels of DPPA3 were significantly lower, but still detected, suggesting some level of embryonic expression and potentially a function for DPPA3 at this stage of development. Since DPPA3 directly interacts with TET proteins to exert some of its functions, 11 we mined our RNA-Seq data set to identify transcript levels and expression of different TET genes. We observed that TET2 and TET3 were highly expressed in the oocytes, with declining toward EGA and their expression at the 8-cell stage not diminished by transcriptional inhibition. Further, TET1 was detected starting at the 8-cell stage and increased in blastocysts; also its expression at EGA was blocked by transcriptional inhibition, indicating expression from the embryonic genome. In mice, a pattern similar to the one reported here has been observed, with a switch in TET gene utilization during the early stages of development. 12,13 In mice, DPPA3 plays a role in DNA methylation remodeling, preimplantation development, embryonic stem cell (ESC) differentiation, and primordial germ cell (PGC) development. 3,6,9,14,15 To better understand the role of DPPA3 in bovine zygote and embryo development, we assessed the effect of DPPA3 knockdown in oocytes on developmental competence and DNA methylation reprogramming. Injection of DPPA3 sirna into GV oocytes resulted in a more than 90% reduction of DPPA3 mrna levels by the MII stage, while not affecting TET2 mrna levels. A similar approach has been used to study the role of other 1274 Epigenetics Volume 9 Issue 9

genes in bovine oocytes and early embryos. 16,17 Unfortunately, because of the lack of bovine specific DPPA3 antibodies and the low conservation of DPPA3 protein across species, we could not assess the effect of DPPA3 sirna injection on DPPA3 protein levels. On the other hand, functional consequences of DPPA3 sirna injection, but not control-sirna injection, indicate that the approach was effective at impairing at least some functions of DPPA3. At the epigenetic level, DPPA3 is involved in protecting the maternal PN from 5mC oxidation to 5hmC, while the paternal PN undergoes this modification, which results in asymmetric remodeling of the parental chromatin. Knockdown of DPPA3 in bovine oocytes resulted in an increased level of 5hmC at the maternal PN and abolishment of the asymmetric pattern of 5hmC staining among parental PNs. These results indicate that DPPA3 plays a role in preventing the oxidation of 5mC to 5hmC in cattle maternal PN. In mice, DPPA3 is known to inhibit TET3 oxidation activity at loci occupied by H3K9me2, which are specific to the maternal PN and some imprinted genes in the paternal PN. 9 Asymmetric H3K9me2 marks have been reported in bovine PN stage embryos, 18 and asymmetric staining to 5mC and 5hmC has also been reported. 13 In this study we observed differences in 5mC and 5hmC between maternal and paternal PN at the late PN stage of bovine development. However, the differential staining of the PN was not as distinct as observed in the mouse. Other studies have also reported that, compared with the mouse, paternal DNA demethylation is less intense in cattle, being more similar to observations in humans. 19-22 Surprisingly, the increase in 5hmC in the maternal PN did not result in decreased 5mC levels, although the differential in 5mC fluorescence intensity between PN was 33% lower in DPPA3 sirna compared with the other groups (Fig. 3B). Wossidlo et al. showed that in PN3 stage mouse zygotes, the 5hmC signal in the maternal genome increases about 2-fold, whereas the 5mC signal declines slightly. 13 These results and our own suggest that the conversion on 5mC to 5hmC is not directly correlated. Spearman s nonparametric correlation between 5mC and 5hmC for non-injected oocytes was -0.71; while in the DPPA3 sirna group the correlation between 5mC and 5hmC was low and not significant. Overall, our data indicate that oocyte-derived DPPA3 protects the maternal DNA from hydroxymethylation. Figure 6. Effect of DPPA3 knockdown in bovine oocytes on cell number and allocation of resulting blastocysts. Representative images of embryos immunostained for SOX2 and CDX2 as markers of ICM and TE cells, respectively. Nuclei were counterstained with Hoechst33342. Scale bar = 50 μm. (B) Average number of cells and ratio of ICM:TE cell number in embryos produced from control and DPPA3 sirnainjected oocytes. ICM: inner cell mass; TE: trophectoderm. a,b : Different letters indicate significant differences (P < 0.05). In mice, TET3 is the most abundant TET family member in oocytes and DPPA3 has been shown to inhibit its activity. 9 In cattle, we also detected high levels of TET2 as well as TET3 in oocytes and cleavage stage embryos. A recent study also showed expression of TET2 in embryos, although to a lesser extent than TET3. 23 Importantly, human DPPA3 has been shown to inhibit both TET2 and TET3 activity by direct binding to their catalytic domain. The putative DNA-binding domain of human DPPA3 (a.a. 20 95) was responsible for its binding and inactivation of TET2 and TET3, but did not bind or inactivate TET1. It has also been shown that the DNA binding domain in DPPA3 not only recognizes and inactivates TET2 and TET3, but that it also recognizes a consensus DNA sequence. The consensus binding sequence was found in multiple imprinted loci, which are likely protected by DPPA3 from DNA demethylation, not only during early development but at later stages too. Thus, localization of DPPA3 to specific loci is likely regulated by both H3K9me2 and DNA sequence. 11 The combination of these mechanisms may be important for DPPA3 s ability to protect the female PN from widespread DNA demethylation and also specific loci, such as www.landesbioscience.com Epigenetics 1275

imprinted genes, at later embryonic stages and in somatic cells where DPPA3 levels of expression are lower, such as found in this study for blastocyst stage embryos. Preimplantation development of IVF and parthenogenetic embryos was compromised in DPPA3 sirna-injected oocytes. Results showed that cleavage rate was decreased in DPPA3- downregulated embryos. A previous study in mice showed that NSN (not surrounded nucleolus) oocytes which did not have DPPA3 could not develop to the 2-cell stage. 24 Another study indicated that most DPPA3 knockout mouse oocytes were fragmented or showed abnormal cleavage at the 2- and 4-cell stages. 3,6,14 These studies suggest that DPPA3 may have a role in early cleavage divisions. Also, development to the blastocyst stage was compromised in DPPA3 knockdown oocytes after IVF or PA. We observed a blastocyst rate of 8.7 and 15.6% for DPPA3 knockdown embryos after PA and IVF, respectively, compared with > 30% for controls. Payer et al. indicated that only 8% of mouse embryos derived from maternal and paternal DPPA3-null gametes reached the blastocyst stage, while 19% reached the BL stage when DPPA3-null females were mated by a wild-type male. 3 This is in agreement with our observations and strongly indicates that DPPA3 plays an important role in early development. In this study, as well as in mice studies, the suppression of DPPA3 function resulted in reduced developmental capacity of the oocytes. This could be the result of preventing the asymmetric remodeling of the oocytes or of an alternative function for DPPA3. The reasons for asymmetric reprogramming of maternal and paternal PN are not completely clear. Bi-maternal embryos (parthenogenetic or gynogenetic) can develop to the blastocyst stage at normal rates. 25 However, these embryos cannot develop to term because of imprinting abnormalities, which cause defects during the post-implantation period. Therefore, it is unlikely that the prevention of asymmetric remodeling of parental PN is the cause of decreased preimplantation development. On the other hand, diploid androgenetic embryos do not develop to blastocysts at the same rate that parthenogenetic and fertilized embryos do. 25,26 In androgenetic embryos, none of the PN are protected from 5mC to 5hmC conversion, while in parthenogenetic embryos the opposite is true, since both PNs would have high levels of H3K9me2 and are thus protected by DPPA3. Interestingly, in the current study, knockdown of DPPA3 in parthenogenetic embryos resulted in reduced developmental capacity to blastocysts. On the other hand, knockout of TET3 in mouse oocytes does not compromise preimplantation development. 8 Overall, these information suggests that oxidation of 5mC to 5hmC is not required for preimplantation development (evidenced by normal development of PA embryos and of TET3 KO embryos), but that the protection of at least 1 PN from 5hmC conversion may be required for normal preimplantation development (evidenced by decrease development of DPPA3 knockout and knockdown both after fertilization and PA, and lower development of androgenetic embryos). Also, the asymmetric remodeling of PN does not seem to be necessary for development as long as at least one of them is not hydroxymethylated. Typically, ICM and TE differential staining techniques are based on cell position within the embryo. In this study we used immunostaining for ICM and TE markers to identify cell lineages not only based on their position but also on their molecular characteristics. SOX2 and CDX2 were selected as markers for ICM and TE, respectively, given their specificity of expression and important functional role in their respective lineages. 27,28 As expected, the two antibodies stained cells of the specific lineages as verified by the position of the cells within the embryo. Analysis of the different embryos indicated a decrease in ICM cell number in the DPPA3 sirna group in comparison to the non-injected group, but not when compared with the control-sirna group. DPPA3 has been implicated in maintenance of the pluripotent state and is found expressed in human and mouse ESC. We detected DPPA3 at the blastocyst stage, although at much lower levels than those observed in oocytes. Whether the reduction in the number of ICM cells is due to depletion of DPPA3 before EGA, or to extended effects of the sirna injection through blastocyst stage, is not clear. Data from our laboratory indicate that sirna injection in oocytes can affect gene expression in blastocysts, although the levels of suppression are more modest (50 60% vs > 90% reduction in blastocysts and cleavage stages, respectively). Interestingly, DPPA3-negative mouse ESC show higher propensity to differentiate toward trophectoderm than DPPA3-positive ESC. 15 Similarly, in human ESC, overexpression of DPPA3 suppresses expression of trophectoderm-associated genes, including CDX2, during induced differentiation. 29 These results together with our finding that embryos from DPPA3 sirna-injected oocytes tend to have lower ICM cell numbers suggests that DPPA3 may play a role in suppressing differentiation of pluripotent cells toward the TE lineage. As an alternative possibility, the abnormal epigenetic state produced by DPPA3 knockdown, may result in alteration of differentiation patterns during early embryogenesis. In conclusion, our results reveal an important role of DPPA3 for normal bovine embryonic development and protecting the maternal PN from cytosine hydroxymethylation. Materials and Methods All chemicals and reagents were purchased from Sigma Chemical Co. (St. Louis, MO) and Life Technologies (Grand Island, NY) unless stated otherwise. RNA-seq data To assess expression of DPPA3 and TET family genes during bovine preimplantation development, we mined data produced in our laboratory using RNA-seq as previously described. 30,31 Briefly, 3 4 groups of 10 in vitro matured oocytes and in vitro produced embryos were used per stage of development. In a group of embryos, α-amanitin was added at the zygote stage at 50 μg/ ml and 8-cell embryos collected 56 h post fertilization. RNA was extracted using the Picopure RNA isolation kit (Applied Biosystems, Carlsbad, CA) and amplified using the Ovation RNA-Seq V2 kit (NuGen, San Carlos, CA). Libraries were constructed using the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA) and sequenced in a HiSeq 2000 apparatus as 100 bp 1276 Epigenetics Volume 9 Issue 9

single reads. Sequence reads were mapped to the bovine UMD3.1 genome assembly and Ensembl 74 genebuild annotation using CLC Genomics Workbench 7.0 (CLCbio, Aarhus, Denmark). Reads per million mapped reads per kilobase of exon model (RPKM) values were calculated for each gene and the levels of expression compared among groups using EdgeR with FDR correction for multiple testing. Oocyte collection, in vitro maturation, parthenogenetic activation and in vitro fertilization Bovine ovaries from adult cows were collected from a local abattoir and transported to the laboratory at 28 30 C. Cumulus oocytes complexes (COCs) were aspirated from 3 8 mm follicles. COCs with intact cumulus cells were randomly divided into three groups. One group of 50 oocytes was cultured for 22 h at 38.5 C in 400 μl of maturation medium (TCM- 199 supplemented with sodium bicarbonate, 10% FBS, 0.1 mm ALA-Glutamine, 0.2 mm 5 μg/ml Gentamicin, 50 ng/ml EGF, 50 ng/ml Ovine FSH, 0.1 mm Cysteamine and 3 μg/ml Bovine LH) in a humidified 5% CO 2 incubator. The second and third groups were processed for sirna microinjection with DPPA3 and control sirna, respectively. After microinjection, groups of 50 oocytes were cultured in a well of a 4-well dish in 400 μl of maturation medium. The matured oocytes were used for IVF and parthenogenetic activation. For IVF, oocytes were fertilized in SOF-IVF medium containing 107.7 mm NaCl, 7.16 mm KCl, 1.19 mm KH2PO4, 0.49 mm, MgCl2, 1.17 mm CaCl2, 5.3 mm sodium lactate, 25.07 mm NaHCO3, 0.20 mm sodium pyruvate, 0.5 mm Fructose, 1X non-essential fatty acid, 5 μg/ml gentamicin, 10 μg/ml heparin, and 6 mg/ml BSA. Approximately 25 expanded COCs were put in each 60 μl drop of fertilization medium. Then, 0.75 10 6 sperm per ml were used for fertilization and expanded COCs + sperm incubated for 18 h at 38.5 C in a humidified atmosphere of 5% CO 2 in air. Cumulus cells were removed by exposure to 1 mg/ml hyaluronidase in SOF- Hepes medium and vortexing for 4 min. Presumptive zygotes were cultured in KSOM (ZEBV-100; Zenith Biotech) supplemented with 4 mg/ml BSA at 38.5 C in a humidified atmosphere of 5% CO 2, 5% O 2 and 90% N 2. After 3 d of culture, the medium was supplemented with 5% FBS (HyClone, Logan, UT). For parthenogenetic activation (PA), matured MII oocytes were denuded of cumulus cells by incubation in 1 mg/ml hyaluronidase and vortexing for 4 min, and activated by exposure to 5 μm Ionomycin (Cal-biochem 407952) for 5 min and 4 h incubation in 2 mm DMAP in KSOM medium at 38.5 C and 5% CO 2 in air. After washing for 3 times, activated oocytes were cultured in KSOM+ BSA as described for IVF embryos. Cleavage and blastocyst rates were evaluated on day 2 and 8 after insemination/activation, respectively, for IVF and PA embryos in at least 4 replicated experiments. sirna microinjection Immediately after collection, COCs were microinjected as described by Ross et al. 32 with minor modifications to accommodate for cumulus-enclosed oocytes, such as increasing the size of the holding pipette. Approximately, 7 pl of solution was injected into each oocyte. Microinjections were performed on a Nikon TE2000U inverted microscope equipped with Narishige micromanipulators and injectors. A solution consisting of 22.5 μm of DPPA3 sirna and 2.5 mg/ml dextran Texas Red in water was injected into the DPPA3 sirna group. The DPPA3 sirna was specifically designed to target bovine DPPA3 isoforms 1 and 2. A non-specific sirna labeled with Alexa Fluor Red was used as control (control sirna). Preliminary trials were done to identify the optimal concentration on DPPA3 sirna (not shown). Groups of 10 15 oocytes were injected at a time to decrease environmental stress. Injection of sirna was verified by brief exposure of oocytes to red fluorescence, and lysed or non-injected oocytes removed from further analysis. Injected oocytes were matured, fertilized or activated, and cultured as described above. RNA extraction and cdna synthesis Total RNA was isolated from pools of 5 MII oocytes or embryos using the PicoPure RNA Isolation Kit (Arcturus, Mountain View, CA) and treated with RNase-free DNase I (Qiagen, Valencia, CA) for removal the genomic DNA according to the manufacturer s instructions. cdna synthesis was performed using Superscript II Reverse Transcriptase with random hexamer priming, following the manufacturer s instructions. Quantitative real-time RT-PCR Real-time RT-PCR was performed using an ABI Prism 7500 Sequence Detection System. The PCR reaction was done in a final volume of 20 μl consisting of 10 μl of 2X Ssofast Mastermix (Biorad, Hercules, CA), 0.4 μl of mixed primer (100 μm stock of each primer), and 5 μl of cdna template. RPL15 was used as a reference gene for the normalization based on our previous work indicating that, for comparisons within the same developmental stage, transcript abundance for this gene is not affected by sirna injection in bovine MII oocytes. 16 Five replicates per group were evaluated. The primers used for RT-PCR are listed in Table 1. Immunofluorescence staining Immunofluorescence staining for 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) was done in late 2PN stage zygotes. SOX2 and CDX2 immunostaining was used to quantify inner cell mass (ICM) and trophectoderm (TE) cells, respectively, in blastocyst stage embryos. 5-methylcytosine and 5-hydroxymethylcytosine staining For 5mC and 5hmC staining, 2PN stage zygotes were collected at 22 h after insemination and washed in PBS+PVA. The zona pellucida (ZP) was gently removed by 10 mg/ml pronase incubation, and zygotes fixed with 4% paraformaldehyde for 15 min. Then, embryos were permeabilized with D-PBS + 1% Triton X-100 for 30 min and treated with 3N HCl for 30 min, following neutralization for 10 min with 100 mm Tris-HCl buffer (ph 8.5). After blocking for 2 h in D-PBS + 0.1%Triton X-100 + 1% BSA + 10% Normal Donkey Serum, zygotes were placed in primary antibody solution consisting of blocking buffer, a mouse monoclonal antibody against 5mC (Eurogentec, BI-MECY-0100, 1:500), and a rabbit polyclonal antibody against 5hmC (Active motif, 39769, 1:2000) overnight at 4 C. After washing for 3 periods of 20 min each, zygotes were incubated with secondary antibodies (Alexa Fluor 568 donkey anti-mouse IgG and Alexa Fluor 488 donkey anti-rabbit www.landesbioscience.com Epigenetics 1277

Table 1. Primer and sirna sequences Name Nucleotide sequences (5 3 ) Fragment size (bp) Accession number DPPA3 F:TGccaTATCTaccaGaaTacccaTCT 100 NM_001111108.2 R:CGCTcacTcaacaccGTTCTTac TET2 F:GCCTCTCTacaaaGTCTC 119 XM_002688092.2 R:CTaacaTccTGACCTTcc RPL15 F: TGGAGAGTATTGCGCCTTCTC 65 AY786141 R: CACAAGTTccaccacacTATTGG DPPA3-siRNA S: GCCAAAGGAAUUCCUCGUUTT - - A: AACGAGGAAUUCCUUUGGCTT F, forward primer; R, reverse primer; S, sense RNA; A, antisense RNA. IgG both at 1:500) at RT for 2 h. DNA was stained by incubating the embryos in washing buffer containing 10 μg/ml of Hoechst33342 for 10 min. Then, after washing three times for one hour, the zygotes were mounted on slides with Prolong Gold antifade reagent (Invitrogen, Carlsbad, CA). Z-stack images were captured using a confocal microscope (Olympus FV1000 Laser Scanning Confocal) using laser excitation and emission filters specific for Hoechst, Alexa488 and Alexa568. Digital images were analyzed by evaluating each pronucleus fluorescent intensity for 5mC and 5hmC using ImageJ-Fiji image processing software (National Institutes of Health, Bethesda, MD). After maximum projection reconstruction of Z-stacks, the fluorescent intensity (average mean gray value) of each channel were measured by manually outlining each pronucleus and adjusted against cytoplasmic background. ICM and TE cell allocation by SOX2 and CDX2 immunostaining Blastocysts were immunostained for SOX2 and CDX2 using a similar protocol as described for 5mC and 5hmC, except that zona removal and acid treatment and neutralization were omitted. Antibodies used were rabbit polyclonal against SOX2 (BioGenex, AN579) and mouse monoclonal against CDX2 (BioGenex, AM392). Slides were observed under a Nikon TE2000U inverted microscope using UV illumination and References 1. Romar R, De Santis T, Papillier P, Perreau C, Thélie A, Dell Aquila ME, Mermillod P, Dalbiès- Tran R. Expression of maternal transcripts during bovine oocyte in vitro maturation is affected by donor age. Reprod Domest Anim 2011; 46:e23-30; PMID:20403124; http://dx.doi. org/10.1111/j.1439-0531.2010.01617.x 2. Thélie A, Papillier P, Pennetier S, Perreau C, Traverso JM, Uzbekova S, Mermillod P, Joly C, Humblot P, Dalbiès-Tran R. Differential regulation of abundance and deadenylation of maternal transcripts during bovine oocyte maturation in vitro and in vivo. BMC Dev Biol 2007; 7:125; PMID:17988387; http:// dx.doi.org/10.1186/1471-213x-7-125 3. Payer B, Saitou M, Barton SC, Thresher R, Dixon JP, Zahn D, Colledge WH, Carlton MB, Nakano T, Surani MA. Stella is a maternal effect gene required for normal early development in mice. Curr Biol 2003; 13:2110-7; PMID:14654002; http://dx.doi. org/10.1016/j.cub.2003.11.026 4. Sato M, Kimura T, Kurokawa K, Fujita Y, Abe K, Masuhara M, Yasunaga T, Ryo A, Yamamoto M, Nakano T. Identification of PGC7, a new gene expressed specifically in preimplantation embryos and germ cells. Mech Dev 2002; 113:91-4; PMID:11900980; http://dx.doi.org/10.1016/ S0925-4773(02)00002-3 5. Saitou M, Payer B, Lange UC, Erhardt S, Barton SC, Surani MA. Specification of germ cell fate in mice. Philos Trans R Soc Lond B Biol Sci 2003; 358:1363-70; PMID:14511483; http://dx.doi.org/10.1098/ rstb.2003.1324 6. Nakamura T, Arai Y, Umehara H, Masuhara M, Kimura T, Taniguchi H, Sekimoto T, Ikawa M, Yoneda Y, Okabe M, et al. PGC7/Stella protects against DNA demethylation in early embryogenesis. Nat Cell Biol 2007; 9:64-71; PMID:17143267; http://dx.doi.org/10.1038/ncb1519 7. Ito S, D Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature 2010; 466:1129-33; PMID:20639862; http://dx.doi.org/10.1038/ nature09303 fluorescence filters specific for each secondary antibody. Images were analyzed using ImageJ-Fiji software (National Institutes Health, Bethesda, MD). Statistical analysis Before any statistical analysis, the normality of data was evaluated. Developmental competence, total cell count in blastocyst stage, 5mC/5hmC signals and real-time RT-PCR data were analyzed by one way ANOVA between all groups. 5mC or 5hmC differences between paternal and maternal pronucleus was evaluated by paired samples t test. Spearman s nonparametric correlation was performed between 5mC and 5hmC. Treatment differences were compared by Tukey s multiple comparison post-hoc test (SPSS 20). Differences were considered as significant at P < 0.05. Acknowledgments We thank the great technical and editorial support provided by James Chitwood, Yanina Bogliotti and Juan Reyes. This project was supported by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) by R01HD070044 to PJR. Supplemental Materials Supplemental materials may be found here: www.landesbioscience.com/journals/epigenetics/article/32087 8. Gu TP, Guo F, Yang H, Wu HP, Xu GF, Liu W, Xie ZG, Shi L, He X, Jin SG, et al. The role of Tet3 DNA dioxygenase in epigenetic reprogramming by oocytes. Nature 2011; 477:606-10; PMID:21892189; http:// dx.doi.org/10.1038/nature10443 9. Nakamura T, Liu YJ, Nakashima H, Umehara H, Inoue K, Matoba S, Tachibana M, Ogura A, Shinkai Y, Nakano T. PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nature 2012; 486:415-9; PMID:22722204 10. Kocabas AM, Crosby J, Ross PJ, Otu HH, Beyhan Z, Can H, Tam WL, Rosa GJ, Halgren RG, Lim B, et al. The transcriptome of human oocytes. Proc Natl Acad Sci U S A 2006; 103:14027-32; PMID:16968779; http://dx.doi.org/10.1073/pnas.0603227103 11. Bian C, Yu X. PGC7 suppresses TET3 for protecting DNA methylation. Nucleic Acids Res 2014; 42:2893-905; PMID:24322296; http://dx.doi.org/10.1093/ nar/gkt1261 1278 Epigenetics Volume 9 Issue 9

12. Iqbal K, Jin SG, Pfeifer GP, Szabó PE. Reprogramming of the paternal genome upon fertilization involves genome-wide oxidation of 5-methylcytosine. Proc Natl Acad Sci U S A 2011; 108:3642-7; PMID:21321204; http://dx.doi.org/10.1073/ pnas.1014033108 13. Wossidlo M, Nakamura T, Lepikhov K, Marques CJ, Zakhartchenko V, Boiani M, Arand J, Nakano T, Reik W, Walter J. 5-Hydroxymethylcytosine in the mammalian zygote is linked with epigenetic reprogramming. Nat Commun 2011; 2:241; PMID:21407207; http://dx.doi.org/10.1038/ncomms1240 14. Bortvin A, Goodheart M, Liao M, Page DC. Dppa3 / Pgc7 / stella is a maternal factor and is not required for germ cell specification in mice. BMC Dev Biol 2004; 4:2; PMID:15018652; http://dx.doi. org/10.1186/1471-213x-4-2 15. Hayashi K, Lopes SM, Tang F, Surani MA. Dynamic equilibrium and heterogeneity of mouse pluripotent stem cells with distinct functional and epigenetic states. Cell Stem Cell 2008; 3:391-401; PMID:18940731; http://dx.doi.org/10.1016/j. stem.2008.07.027 16. Canovas S, Cibelli JB, Ross PJ. Jumonji domaincontaining protein 3 regulates histone 3 lysine 27 methylation during bovine preimplantation development. Proc Natl Acad Sci U S A 2012; 109:2400-5; PMID:22308433; http://dx.doi.org/10.1073/ pnas.1119112109 17. Lee KB, Bettegowda A, Wee G, Ireland JJ, Smith GW. Molecular determinants of oocyte competence: potential functional role for maternal (oocytederived) follistatin in promoting bovine early embryogenesis. Endocrinology 2009; 150:2463-71; PMID:19179440; http://dx.doi.org/10.1210/ en.2008-1574 18. Wu X, Li Y, Xue L, Wang L, Yue Y, Li K, Bou S, Li GP, Yu H. Multiple histone site epigenetic modifications in nuclear transfer and in vitro fertilized bovine embryos. Zygote 2011; 19:31-45; PMID:20609268; http://dx.doi.org/10.1017/s0967199410000328 19. Mayer W, Niveleau A, Walter J, Fundele R, Haaf T. Demethylation of the zygotic paternal genome. Nature 2000; 403:501-2; PMID:10676950; http:// dx.doi.org/10.1038/35000656 20. Beaujean N, Hartshorne G, Cavilla J, Taylor J, Gardner J, Wilmut I, Meehan R, Young L. Nonconservation of mammalian preimplantation methylation dynamics. Curr Biol 2004; 14:R266-7; PMID:15062117; http://dx.doi.org/10.1016/j. cub.2004.03.019 21. Wilmut I, Beaujean N, de Sousa PA, Dinnyes A, King TJ, Paterson LA, Wells DN, Young LE. Somatic cell nuclear transfer. Nature 2002; 419:583-6; PMID:12374931; http://dx.doi.org/10.1038/ nature01079 22. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001; 98:13734-8; PMID:11717434; http://dx.doi.org/10.1073/pnas.241522698 23. Pagé-Larivière F, Sirard MA. Spatiotemporal expression of DNA demethylation enzymes and histone demethylases in bovine embryos. Cell Reprogram 2014; 16:40-53; PMID:24459992; http://dx.doi. org/10.1089/cell.2013.0055 24. Liu YJ, Nakamura T, Nakano T. Essential role of DPPA3 for chromatin condensation in mouse oocytogenesis. Biol Reprod 2012; 86:40; PMID:22034526; http://dx.doi.org/10.1095/biolreprod.111.095018 25. Aravind L, Koonin EV. SAP - a putative DNA-binding motif involved in chromosomal organization. Trends Biochem Sci 2000; 25:112-4; PMID:10694879; http://dx.doi.org/10.1016/s0968-0004(99)01537-6 26. Kono T, Sotomaru Y, Sato Y, Nakahara T. Development of androgenetic mouse embryos produced by in vitro fertilization of enucleated oocytes. Mol Reprod Dev 1993; 34:43-6; PMID:8418815; http://dx.doi.org/10.1002/mrd.1080340107 27. Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B, Roelen BA. Differences in early lineage segregation between mammals. Dev Dyn 2008; 237:918-27; PMID:18330925; http://dx.doi. org/10.1002/dvdy.21480 28. Goissis MD, Cibelli JB. Functional characterization of SOX2 in bovine preimplantation embryos. Biol Reprod 2014; 90:30; PMID:24389873; http:// dx.doi.org/10.1095/biolreprod.113.111526 29. Wongtrakoongate P, Jones M, Gokhale PJ, Andrews PW. STELLA facilitates differentiation of germ cell and endodermal lineages of human embryonic stem cells. PLoS One 2013; 8:e56893; PMID:23457636; http://dx.doi.org/10.1371/journal.pone.0056893 30. Chitwood JL, Rincon G, Kaiser GG, Medrano JF, Ross PJ. RNA-seq analysis of single bovine blastocysts. BMC Genomics 2013; 14:350; PMID:23705625; http://dx.doi.org/10.1186/1471-2164-14-350 31. Iqbal K, Chitwood JL, Meyers-Brown GA, Roser JF, Ross PJ. RNA-seq transcriptome profiling of equine inner cell mass and trophectoderm. Biol Reprod 2014; 90:61; PMID:24478389; http://dx.doi.org/10.1095/ biolreprod.113.113928 32. Ross PJ, Beyhan Z, Iager AE, Yoon SY, Malcuit C, Schellander K, Fissore RA, Cibelli JB. Parthenogenetic activation of bovine oocytes using bovine and murine phospholipase C zeta. BMC Dev Biol 2008; 8:16; PMID:18284699; http://dx.doi. org/10.1186/1471-213x-8-16 www.landesbioscience.com Epigenetics 1279