mirna Whole Transcriptome Assay

mirna Whole Transcriptome Assay

HTG EdgeSeq mirna Whole Transciptome Assay The HTG EdgeSeq mirna Whole Transcriptome Assay (WTA) is a next generation sequencing (NGS) application that measures the expression of 2,03 human micrornas (mirnas) described in the mirbase v20 database. The assay is powered by HTG s quantitative nuclease protection assay and leverages the high sensitivity and dynamic range of NGS. The HTG EdgeSeq instrument automates the nuclease protection step in the library preparation process, significantly reducing the number of hands-on steps for fast and easy use of NGS platforms for mirna analysis. The extraction-free, lysis-only chemistry significantly reduces sample input requirements compared to other methods and allows mirna expression profiling from limited, precious FFPE tissues, cell lines, plasma/serum, PAXgene, and purified RNA. Generate comprehensive mirna profiles with a single assay With 2,03 targeted mirnas, the HTG EdgeSeq mirna WTA provides more complete coverage than competitive platforms by covering 1% of all mature transcripts identified within mirbase v20 and % of the high confidence mirna transcripts identified.

Differentiate between similar mirna transcripts Total Counts 2 Total Counts 2554 234 4425 B. 1-base difference 5 30 A. 2-base difference let-e-5p let-a-5p UGAGGUAGGAGGUUGUAUAGUU UGAGGUAGUAGGUUGUAUAGUU mir-301a-3p CAGUGCAAUGAUAUUGUCAAAGC mir-301b CAGUGCAAUAGUAUUGUCAAAGC Closely-related synthetic mirnas from ABRF are split between pools. The examples show on-target and off-target hybridization of the indicated probes for the indicated pools. In panel A, pool 1 contained mir-301b and not mir-301a-3p while pool 2 contained mir-301a 3p and not mir-301b. In panel B, pool 1 contained let-a-5p and not le-e-5p while pool 2 contained let-e-5p and not let-a-5p. The data demonstrates that the HTG EdgeSeq mirna WTA differentiates targets with 1 2-base differences with a high degree of specificity. Identify or verify disease-specific biomarkers mir-205-5p in lung FFPE 4500 leta-5p in lung FFPE samples 000 4000 000 3500 000 3000 000 2500 4000 2000 2000 1500 0 Adenoca ma (n=) Squamous (n=) A. Differentiation of mir-205-5p 00 Adenocarcinoma (n=) Squamous (n=) B. No differentiation of leta-5p mir-205-5p expression is a highly expressed marker for squamous cell carcinoma in lung cancer (source). The HTG EdgeSeq mirna WTA accurately differentiates squamous and non-squamous lung carcinoma using this marker. As a control, leta-5p expression is shown as a comparison.

Achieve reproducible data using robust platform and chemistry Pr22 day 1 place21 r=0.4 r=0.3 r=0.4 Pr22 day 1 place22 r=0.43 r=0.3 r=0.43 Pr22 day 1 place23.5.5 r=0.4.5.5.5.5.5 r=0. Plate 2, r=0.4 sums, 500fM day 1 2v1 3v1 r=0.05 1v2 Plate 4, sums, 500fM day 2 3v22 r=0. r=0.05 1v3 2v3 Plate 5, sums, 500fM day 3 A. Technical Replicates.5.5.5.5.5.5.5 B. Day/Day Reproducibility An average Pearson correlation value (r) of 0. was achieved for technical (A) and day/day (B) reproducibility. All data were generated using the HTG EdgeSeq mirna Whole Transcriptome Assay and an Illumina MiSeq instrument. The FASTQ data was aligned and expression was measured using the HTG EdgeSeq Parser software. Compatible with plasma and serum Donor plasma sample was profiled using the HTG EdgeSeq mirna WTA. These samples were processed in triplicate. Effective and reproducible profiling is demonstrated with a Pearson correlation value (r) of 0.3. Sequencing data was generated using the Illumina MiSeq instrument. 15 Plasma- -neat-1 r=0. r=0.3 r=0. Plasma- -neat-2 r=0.24 r=0.3 r=0.24 Plasma- -neat-3

Sample Requirements Sample Type FFPE Tissue Plasma Serum PAXgene Cell Lines Purified RNA Sample Input 1.5-.5 mm 2 of a 5 μm section.5 μl.5 μl 32 μl 1,250-5,000 cells.25-25 ng Product Specifications Design Source mirbase v20 Targets 2,03 Process Controls Positive Negative 1 positive probe 5 ANT probes Endogenous Controls Common srna (Pol3) rrna ACTB, B2M, GAPDH, YWHAZ, PPIA RNU4, RNU5, RNY3, SNORA RPL1, RPS20, RPL2, RSP Ordering Information Catalog # Product Name Description illumina (ILM) Next-Generation Sequencing Systems 1-001-20 HTG EdgeSeq mirna WTA ILM (2x) 2 plates, samples/plate 1-001-00 HTG EdgeSeq mirna WTA ILM (4x) 4 plates, samples/plate 1-001-224 HTG EdgeSeq mirna WTA ILM (1x24) 1 plate, 24 samples/plate 1-001-024 HTG EdgeSeq mirna WTA ILM (4x24) 4 plates, 24 samples/plate 1-001-0 HTG EdgeSeq mirna WTA ILM (1x) 1 plate, samples/plate Ion Torrent (IT) Next-Generation Sequencing Systems 1-001-30 HTG EdgeSeq mirna WTA IT (2x) 2 plates, samples/plate 1-001- HTG EdgeSeq mirna WTA IT (4x) 4 plates, samples/plate 1-001-324 HTG EdgeSeq mirna WTA IT (1x24) 1 plate, 24 samples/plate 1-001-4 HTG EdgeSeq mirna WTA IT (4x24) 4 plates, 24 samples/plate Ordering information Email: orders@htgmolecular.com or contact your local sales representative. C US

Empowering precision medicine at the local level HTG Molecular Diagnostics, Inc. 3430 E. Global Loop, Tucson, AZ 50 Call -2-215 Email info@htgmolecular.com Website www.htgmolecular.com For Research Use Only. Not for use in diagnostic procedures. HTG EdgeSeq, HTG Edge and qnpa are trademarks of HTG Molecular Diagnostics, Inc. Any other trademarks or trade names used herein are the intellectual property of their respective owners. Revision 5: 15-JUL-201