Severe XIST hypomethylation clearly distinguishes (SRYC) 46,XX-maleness from Klinefelter syndrome

European Journal of Endocrinology (2010) 162 169 175 ISSN 0804-4643 CLINICAL STUDY Severe XIST hypomethylation clearly distinguishes (SRYC) 46,XX-maleness from Klinefelter syndrome Andreas Poplinski, Peter Wieacker 1, Sabine Kliesch and Jörg Gromoll Centre of Reproductive Medicine and Andrology, University Clinics Münster, Domagkstraße 11, 48149 Münster, Germany and 1 Institute of Human Genetics, Vesaliusweg 12-14, 48149 Münster, Germany (Correspondence should be addressed to J Gromoll; Email: joerg.gromoll@ukmuenster.de) Abstract Objective: 46,XX-maleness affects 1 in 20 000 live male newborns resulting in infertility and hypergonadotrophic hypogonadism. Although the phenotypes of XX-males have been well described, the molecular nature of the X chromosomes remains elusive. We assessed the X inactivation status by DNA methylation analysis of four informative loci and compared those to Klinefelter syndrome (KS) and Turner syndrome. Design and methods: Patient cohort consisted of ten sex-determining region of the Y (SRYC) XX-males, two (SRYK) XX-males, ten 47,XXY Klinefelter men, six 45,X Turner females and ten male and female control individuals each. Methylation analysis was carried out by bisulphite sequencing of DNA from peripheral blood lymphocytes analysing X-inactive-specific transcript (XIST), phosphoglycerate kinase 1 (PGK1), ferritin, heavy peptide-like 17 (FTHL17) and short stature homeobox (SHOX). Results: XIST methylation was 18% in (SRYC) XX-males, and thus they were severely hypomethylated compared to (SRYK) XX-males (48%; P!0.01), Klinefelter men (44%; P!0.01) and female controls (47%; P!0.01). Turner females and male controls displayed a high degree of XIST methylation of 98 and 94% respectively. Methylation of PGK1, undergoing X inactivation, was not significantly reduced in (SRYC) XX-males compared to female controls in spite of severe XIST hypomethylation (51 vs 69%; PO0.05). FTHL17, escaping X inactivation, but undergoing cell-type-specific inactivation was similarly methylated in XX-males (89%), KS patients (87%) and female controls (90%). SHOX, an X inactivation escapee located in the pseudoautosomal region, displays similarly low degrees of methylation for XX-males (7%), KS patients (7%) and female controls (9%). Conclusions: XIST hypomethylation clearly distinguishes (SRYC) XX-males from Klinefelter men. It does not, however, impair appropriate epigenetic regulation of representative X-linked loci. European Journal of Endocrinology 162 169 175 Introduction Sex chromosomal aberrations are a frequent cause of male and female infertility. 46,XX-maleness is a rare sex chromosomal anomaly that affects 1 in 20 000 newborn males. Ninety percent of XX-males are designated sex-determining region of the Y (SRYC) 46,XX-males as translocation of Y chromosomal material including SRY triggers testis formation in these men (1). However, 10% of XX-males lack SRY and are thus designated (SRYK) XX-males. In these men, masculinisation is induced by upregulation of the transcription factor SOX9 that triggers testis formation independently from SRY (2). XX-males are characterised by hypergonadotrophic hypogonadism and reduced body height, increased incidence of gynecomastia and maldescended testes compared to 46,XY males. In comparison to 46,XY healthy males, these men display significantly reduced testosterone levels, and severely elevated levels of FSH and LH. Reduction of bitesticular volume to one-tenth that of normal males reflects exclusive azoospermia, and as residual spermatogenesis in the testis has not yet been reported, assisted reproduction techniques (ARTs) are no option for reproduction in these patients. Detailed molecular studies of the supernumerary X chromosomes in these patients are rare. It is known, however, that X chromosome inactivation in these patients follows a random pattern with a significant proportion of them exhibiting extreme skewing (3). The most frequent sex chromosomal aneuploidy in men is 47,XXY Klinefelter syndrome (KS) with a prevalence of 0.1 0.2% in newborn males and 11% among azoospermic infertile men (4, 5). KS patients display hypergonadotrophic hypogonadism, gynaecomastia and reduced pubic hair; the testes are small and firm due to spermatogenic impairment (6). Oligozoospermic ejaculates and residual active foci of spermatogenesis in testicular biopsies have been observed (7, 8), and the use of ART by testicular sperm extraction has been q 2010 European Society of Endocrinology DOI: 10.1530/EJE-09-0768 Online version via

170 A Poplinski and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 successful in several reported cases (9 11). Although endocrinological features of these men including reduced testosterone and LH levels have been described (3), the precise molecular role of the supernumerary X chromosome has not been elucidated in KS yet. A sex chromosomal anomaly affecting women is the 45,X Turner syndrome. It has an incidence of 1:2000, and is caused by the complete or partial absence of the second gonosome (12). Decreased body height, ovarian dysgenesis, accelerated oocyte apoptosis and oestrogen deficiency leading to severely impaired fertility are classical symptoms in these women (13). Of particular importance for X chromosomal gene dosage compensation between the sexes is the X chromosome inactivation. It is initiated embryonically by the expression of the X-encoded X-inactive-specific transcript (XIST) that is exclusively transcribed from the inactive X chromosome (14, 15). Expression of XIST triggers silencing of the X chromosome in cis and leads to DNA methylation of promoter regions of several inactivated X-linked loci (16, 17). This silencing process is incomplete on the inactive X chromosome as about 15% of the genes on the inactive X chromosome are expressed and designated escapees (18, 19). XIST expression is subjected to a strict transcriptional control through DNA methylation. Hypomethylation of XIST leads to the overexpression of XIST and inappropriate inactivation of X-linked genes (20). X chromosomal genes can be classified into different categories depending on the mechanism of transcriptional regulation. These are represented by the following genes in this study. Phosphoglycerate kinase 1 (PGK1) belongs to the genes subjected to X inactivation, and its status is thus directly affected by XIST expression. It is silenced by DNA methylation on the inactivated X chromosome and is expressed from the active X chromosome, and can serve as an indicator of X chromosome inactivation (21, 22). Short stature homeobox (SHOX) is regulated in a developmental manner and is of particular importance for the phenotypic appearance of women with 45,X Turner syndrome; its expression is essential in growth plates and is in tight correlation with body height (23). It is located in the pseudoautosomal region of the gonosomes and escapes X inactivation on the inactive X chromosome. A third gene on the X chromosome, ferritin, heavy peptide-like 17 (FTHL17), has been shown to be expressed solely in spermatogonia and silenced in somatic cells (24, 25). Hence, it represents those X-linked genes that display cell-type-specific expression. The aim of this study was to delineate the epigenetic status of the X chromosome in XX-males in comparison with Klinefelter patients and women with Turner syndrome to analyse the impact of the sex chromosomal constitution on X inactivation. It utilises representative X chromosomal loci to depict the impact of different sex chromosomal constitutions on differential transcriptional regulation by DNA methylation. Moreover, it aims to gain new useful information about the epigenetic nature of the X chromosomes in XX-maleness. Subjects, materials and methods Patients Ten hitherto untreated (SRYC) 46,XX-male patients and ten 47,XXY Klinefelter patients were chosen for epigenetic characterisation from the cohort that was genetically, endocrinologically and clinically described in detail by Vorona et al. (2007). Patients ages ranged from 14 to 46 for XX-males and from 20 to 42 for Klinefelter patients. The male control group consisted of ten men who served as semen donors in the Centre of Reproductive Medicine and Andrology. They had no chromosomal aberrations, and semen analysis proved these men to be normozoospermic. The female control group consisted of ten women with normal ovarian function as determined by repeated hormone assessments and ultrasonographic demonstration of regular ovulation. They represented the proven healthy female partners in couples seeking advice for infertility, with husbands presenting with decreased sperm parameters. All patients and volunteers provided written informed consent, and agreed to the assessment of genetic material as approved by the Ethics Committee of the University Clinics Münster and the State Medical Board. Genetic and cytogenetic characterisation Cytogenetic analysis was performed on lymphocytes as described by Vermeulen et al. (1999) (26). For (SRYC)- and (SRYK)-46,XX males and 47,XXY Klinefelter patients, 30 metaphase cells were assessed by fluorescence in situ hybridisation (FISH) analysis using a SRY probe (Vysis, Hoofddorp, The Netherlands). DNA isolation Genomic DNA was extracted from peripheral lymphocytes from 1 ml EDTA blood using the FlexiGene Kit (Qiagen) according to the manufacturer s instructions. Bisulphite conversion Two micrograms of genomic DNA in a volume of 50 ml were incubated with 5.5 ml 3 M NaOH for 15 min at 37 8C. After denaturation at 95 8C for 2 min, DNA was placed on ice. Five hundred microlitres of bisulphite solution (5 M sodium bisulphite and 100 mm hydroquinone (Sigma Aldrich)) were added, and the reaction mixture was incubated at 55 8C for 16 h. Converted DNA was desalted using the DNA cleanup Wizard

EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 (Promega) following the standard instructions. To the desalted DNA, 5.5 ml of 3 M NaOH were added, and it was incubated for 15 min followed by ethanol precipitation; bisulphite-treated DNA was resuspended in 20 ml aqua dest. Amplification of differentially methylated regions Regions of interest were amplified from 4 ml bisulphite DNA. PCR mixture (25 ml) contained 1! reaction buffer (Qiagen), 1.5 mm MgCl 2, 100 mm of each dntp (Promega), primers in the concentration given below (Eurofins MWG, Ebersberg, Germany) and 1.5 U Taq Polymerase (Qiagen, 5 U/ml). PCR conditions were 3 min at 95 8C followed by 40 cycles of 94 8C; 30 s, primer annealing (see below for temperature; 30 s), 72 8C, 30 s and a final extension at 72 8C for 10 min. PCR products were purified using the High Pure PCR Product Purification Kit (Roche) according to the manufacturer s manual. Identification of potentially methylated regions The sequence of the first exons and the region 1000 bp upstream of the desired genes were retrieved from Entrez Gene (http://www.ncbi.nlm.nih.gov/sites/entrez) and for the identification of CpG islands, the online program MethPrimer (Li & Dahiya 2002 (27); http://www. urogene.org/methprimer/) was used. This tool yields the location of possible CpG islands. Minimum requirements for a CpG island were a ratio of observed/expected CpGs O0.6 and a percentage of CG O50%. Primers were picked around CpG-rich areas. Primer sequences for XIST were adapted from Song et al. (2007) (28). Primer sequences (5 0 3 0 ) and PCR conditions XIST_fwd: GTAGAGAATGATTTTGTAGTTAAGT- TAAGG XIST_rev: ATCTTACCTCCCTAATTTAACTTAACAC. Location: Xq13.2 (M97168) Product size: 133 bp; annealing temperature: 60 8C (K0.1 8C/cycle) FTHL17_fwd: TTTTTGTTATTTTAGTTGTTGTTTT FTHL17_rev: ACTTCTAAACATACTCCATTTTATC. Location: Xp21.2 (AF285592) Product size: 285 bp; annealing temperature: 59 8C SHOX_fwd: GGGATTTTTTGTAGTTTTAGTTTTGT SHOX_rev: ACCCTAATTACATTAACCCCAATAC. Location: Xp22.33 and Yp11.32 (U82668) Product size: 321 bp; annealing temperature: 58 8C PGK1_fwd: GTTTTTTTTAAGGTAGTTTTGGGTTTG PGK1_rev: CRCTATTAACCACAACCCATC. Location: Xq13.3 (L00159) Product size: 318 bp; annealing temperature: 60 8C. Methylation analysis by bisulphite sequencing PCR products were cloned into pgem T vector (Promega) and competent Escherichia coli were heatshock transformed with the resulting plasmids. The plasmids of at least ten clones were isolated and sequenced for methylation analysis. Methylation analysis by dye-terminator sequencing The extent of methylation was determined by direct sequencing of PCR fragments by Qiagen GmbH. All sequencing reaction mixes were based on the BigDye 3.1 Terminator chemistry (Applied Biosystems, Carlsbad, CA, USA). Template amounts of 5 ng per 100 bases of fragment length and 10 pmol primer per reaction were used. Reaction mixtures were cycled in a GeneAmp PCR System 9700 (Applied Biosystems) and purified using DyeEx (Qiagen). Data collection was carried out on a 3730!l DNA Analyser (Applied Biosystems) equipped with 50 cm capillary arrays and POP-7 polymer. After data collection, the raw data channels from the generated result files (.ab1) were processed using custom-built software developed at Qiagen. Data processing involved the compensation of the different migration properties of the four dyes, baseline correction, peak detection and base calling. For each base, the area was calculated from the corresponding peak to measure the base s quantity. Bases that correspond to variable positions of CpG sites were identified by comparison of the obtained sequence with a reference sequence. The ratios of methylated versus unmethylated species (C/T in forward reads and G/A in reverse reads) were reported. Data analysis and plotting For bisulphite sequencing data, the ratio of methylated sites to unmethylated sites in all sequenced clones yielded the mean degree of methylation of a given region. For dye-terminator sequencing, the mean of all analysed sites yielded the mean degree of methylation. For visual presentation of the data and for statistical analysis, GraphPad Prism (GraphPad Software, La Jolla, CA, USA) was used. Results Epigenetics of the X in XX-maleness 171 Severe hypomethylation of XIST in SRY(C) XX-males We determined the DNA methylation status of XIST in (SRYC) 46,XX-males to assess the impact of their sex chromosomal constitution on the epigenetic state of the X chromosome. We therefore analysed a 133 bp fragment (from C871 to C1003; according to Song

172 A Poplinski and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 et al. 2007 (28)) containing five potential methylation sites (Fig. 1a) in ten SRY(C) XX-males compared to 47,XXY KS patients and ten female controls. A single CpG site methylation analysis revealed that KS patients and female controls displayed highly similar degrees of XIST methylation (Fig. 2a). The mean methylation per CpG site in KS patients was between 42 and 47%, which is comparable to female controls who displayed a XIST methylation of 46 48%; these values correlate with the presence of two X chromosomes. The degree of methylation was highly consistent over the five analysed CpG sites of XIST. The distribution of the overall mean XIST methylation per individual showed the same heterogeneous pattern in KS men and female controls, ranging from 20 to 70% in both groups (Fig. 2c). In contrast, a strong deviation from the expected XIST methylation was observed in (SRYC) XX-males. They displayed XIST methylation from 16.5 to 19.3% and are thus severely hypomethylated compared to KS patients and female controls (P!0.001). On an individual basis they showed considerable variation of XIST methylation ranging from a complete unmethylation in one patient to 45% methylation in another, similar to 46,XX female controls and 47,XXY KS men (Fig. 2c). We aimed to assess the influence of the Y chromosomal material that SRY(C) XX-males carry as translocation to one of their X chromosomes, and to further characterise the impact of different sex chromosomal constitutions on XIST methylation. We therefore compared XIST methylation of SRY(C) XX-males to that of SRY(K) XX-males, 46,XY male controls and 45,X Turner patients. (SRYK) XX males display XIST methylation of 45 50%, depending on the CpG site; this represents a significantly elevated degree of XIST methylation compared to SRY(C) XX-males (P!0.001) and is rather comparable to female controls. Normal males have, on average, a high degree of XIST methylation ranging from 88 to 96% depending on the CpG site (Fig. 2a) and they showed a very homogeneous Figure 2 Mean methylation of a 133 bp fragment in the 5 0 region of XIST as determined by bisulphite sequencing of DNA from lymphocytes. Error bars represent S.E.M. Significance was calculated by one-way ANOVA followed by a Bonferroni s post-hoc test. A statistical significance of P!0.001 is indicated by *. (a) XIST methylation of (SRYC) 46,XX-males compared to that of 47,XXY Klinefelter males and female controls. Bars give mean XIST methylation of patients with different karyotypes at individual CpG sites; (b) XIST methylation of (SRYC) 46,XX-males compared to that of (SRYK) 46,XX-males, 46,XY male controls and 45,X Turner females; (c) individual XIST methylation of patients with different karyotypes. Each dot represents the mean XIST methylation over the analysed five CpG sites of one individual patient. Lines indicate mean and S.E.M. high degree of XIST methylation (Fig. 2b), similar to 45,X women with highly methylated XIST levels of 97 99% (Fig. 2b). Figure 1 Localisation and number of CpG sites of the analysed X-linked genes. CpG-rich regions (CpG islands) were identified by Methprimer, and PCR primers were designed to amplify the indicated regions. Given coordinates indicate the position of the analysed fragment in relation to the transcription start site. Lollipops represent CpG methylation site within the fragments. (a) XIST, 133 bp, five CpG sites; (b) PGK1, 318 bp, 38 CpG sites; (c) FTHL17, 285 bp, 24 CpG sites; (d) SHOX, 321 bp, 28 CpG sites. DNA methylation state of representative X chromosomal genes We next addressed the question of whether sex chromosomal anomalies, in particular (SRYC)-XXmaleness associated with XIST hypomethylation, result

EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 in an abnormal epigenetic state of X chromosomal loci. Hence, we analysed three representative X chromosomal genes, PGK1, FTHL17 and SHOX, for the presence of CpG islands using MethPrimer (27) and designed suitable PCR primers. PGK1 was chosen as an indicator of X chromosome inactivation harbouring a CpG island in its promoter. We analysed a 318 bp fragment from K338 to K21 relative to the transcription start site (Fig. 1b) comprising 38 CpG methylation sites in (SRYC) XX-males, KS males and 45, X women controlled by healthy men and women. (SRYC) XX males and KS men displayed a nonsignificant (PO0.05) reduction of PGK1 methylation to 51 and 56% respectively (Fig. 3a) compared to female controls who had 69% PGK1 methylation. PGK1 methylation was 3.4% in male controls; this value was significantly lower compared to that in female controls (P!0.001), but comparable to PGK1 methylation in 45,X Turner women (0.4%). FTHL17 represents X-linked genes that do not undergo X inactivation, but are regulated in a celltype-specific manner. We hypothesised that FTHL17 might be a suitable candidate to indicate whether this differential regulation is impaired by the abnormal sex chromosomal constitution in SRY(C) XX-males and other sex chromosomal aberration. Analysis of the coding sequence of FTHL17 revealed a predicted CpG island in the first exon (Fig. 1c) and a 285 bp fragment from C24 to C308 relative to the transcription start site comprising 24 CpG methylation sites was chosen for subsequent analysis. Male and female controls showed a high degree of FTHL17 methylation of 91 and 90% respectively, indicative of a high inactivation status (Fig. 3b). No difference in FTHL17 methylation was found in (SRYC) XX-males (89%), KS men (87%) or 45, X women (93%). SHOX is located in the pseudoautosomal region of the X and escapes X inactivation; it therefore represents the so-called escapees. We analysed a 321 bp fragment from K375 to K55 relative to the transcription start site of SHOX comprising 28 CpG sites (Fig. 1d). Female and male controls showed a low degree of SHOX methylation with 9 and 7% respectively (Fig. 3c). (SRYC) XX-males displayed, on average, a similar degree of SHOX methylation as male controls and KS men (7%), while in 45, X women a comparably low degree of methylation was detected (4.8%). Discussion Epigenetics of the X in XX-maleness 173 X chromosome inactivation represents an essential mechanism to balance the X chromosomal gene dosage between the sexes. Sex chromosomal aberrations, however, constitute a major thread to this finely tuned process. We present the first descriptive and comparative study of the DNA methylation status of the X chromosome in XX-maleness, KS and Turner syndrome. The study of general molecular features of XX-maleness is always limited by the naturally small study cohort due to the extreme rarity of this syndrome. It is especially difficult to get hold of samples from (SRYK) XX-males as only about 10% of 46,XX-males lack a translocation of Y chromosomal material to one of their X chromosomes (2, 29, 30). However, our cohort of ten (SRYC) XX-males represents one of the largest cohorts ever reported (31). We could clearly demonstrate that hypomethylation of XIST is a common feature of these men with a significant reduction of XIST methylation from about 50 to 20% on average when compared to female controls and KS men. Despite this epigenetic aberration, three relevant X-linked genes representing X inactivation (PGK1), escape from X inactivation (SHOX) and cell-type-specific inactivation (FTHL17) were normally methylated at their CpG islands when compared to those in female controls and Klinefelter patients, indicating comparably normal X inactivation. As XIST RNA expression is coupled to its DNA methylation status (20), it would obviously be a vital investigation to compare actual XIST expression in XX-males to that in KS men and female controls. This would yield the information whether XIST methylation still dictates XIST expression in (SRYC) XX-males. However, this study has been performed retrospectively and owing to the poor availability of a sufficient number of fresh blood samples from XX-males it is not feasible at the moment to back-up our epigenetic findings with expression data. Figure 3 Methylation analysis of X-linked PGK1, FTHL17 and SHOX. Columns represent the mean methylation of all analysed CpG sites of all individuals in a given group. Error bars indicate S.E.M., and significance was calculated by one-way ANOVA followed by a Bonferroni post-hoc test. (a) PGK1; (b) FTHL17; (c) SHOX.

174 A Poplinski and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 It has been described earlier that XIST expression becomes dispensable for X inactivation once it is established (32). Silencing of the inactive X chromosome is then overtaken by histone modifications, such as extensive H3K27 methylation that is conferred by the Polycomb repressive complex 2 (33). However, if this would confer relaxed stringency to the DNA methylation status of XIST, female controls and KS men could as well display severely changed XIST methylation levels. As this is not the case, other hitherto unknown factors must account for the massive hypomethylation of XIST that remain elusive. One important finding in our study is that the two (SRYK) XX-males displayed female-like 50% XIST methylation. This finding assigns a crucial role to the Y X translocation in (SRYC) XX-males in the aetiology of severe XIST hypomethylation. As proposed and indicated earlier (34), KS men in this study undergo appropriate X chromosome inactivation. The striking epigenetic similarities of the X chromosomes of KS patients and women in terms of methylation status and variation suggest that insufficiency and apoptosis of Leydig cell in KS men (7) could be due to the female expression pattern in these cells that could compromise their function. Although no functional proof of escapee transcripts can be given here, the epigenetic analysis suggests that KS men, like women, express genes from the second X that escapes X inactivation. We thus strengthen the hypothesis that these escapees, which are present in women and KS men, but not in normal men, are major contributors to the phenotypes in KS (35). Our data support the concept of inter-individual variation of X inactivation. Earlier studies demonstrated that X-inactivated genes show substantial variation of expression between different women accompanied by variable retention of epigenetic silencing mechanisms (36). Earlier findings that females show considerable heterogeneity in levels of X-linked expression (19) have recently been backed up by the report that both X-inactivated genes and escapees show significant variation of expression (37). The wide variation of XIST methylation in all XX-carrying patients and controls in this study reflects the general heterogeneity of X-linked expression in individuals with two X chromosomes. A number of characteristics that distinguish (SRYC) XX-males from KS men have been described before. These include anthropomorphic features such as reduced body height and an increased incidence of maldescended testis, elevated LH levels, significantly reduced creatinine levels and extremely skewed inactivation of the androgen receptor located on the X chromosome (3). Karyotypically, the difference between these syndromes is that KS men possess a complete Y chromosome, whereas (SRYC) XX-males only carry an SRY-containing fragment translocated to one of their X chromosomes (38). This partially explains why the latter are exclusively infertile due to the absence of male fertility-related regions on the Y chromosome, including AZF (39), whereas the former sometimes display residual active foci of spermatogenesis (7, 8). The severe XIST hypomethylation of (SRYC) XX-males indicates that there might be more hitherto unidentified epigenetic differences. In summary, we provide strong evidence that XIST hypomethylation in (SRYC) XX-males is a substantial epigenetic hallmark of this chromosomal anomaly. It associates the anthropomorphic and biochemical distinction of (SRYC) XX-maleness from KS with a characteristic epigenetic pattern. Both Klinefelter patients and (SRYC) XX-males share the characteristic pattern of hypergonadotrophism indicating a severely impaired endocrine feedback regulation and an in general normal inactivation of X-linked genes. The fact that presumably only XIST methylation distinguishes both entities points to a hitherto unknown impact of the Y chromosome on X inactivation. Thus, future studies will have to elucidate the impact of the X Y-chromosomal crosstalk on the endocrine status and phenotypic characteristics in correlation to the sex chromosomal constitution. Declaration of interest The authors certify that they have no affiliation with or financial involvement in any organisation or entity with a direct financial interest in the subject matter or materials discussed in the manuscript. Any research support is identified. Funding This study was supported by the Deutsche Forschungsgemeinschaft DFG GR 1547/8-1. Acknowledgements We thank Nicole Terwort for excellent technical assistance. Michael Zitzmann, Elena Vorona and Andreas Schüring are thanked for clinical characterisation of patients. References 1 Huang WJ & Yen PH. Genetics of spermatogenic failure. Sexual Development: Genetics, Molecular Biology, Evolution, Endocrinology, Embryology, and Pathology of Sex Determination and Differentiation 2008 2 251 259. 2 Kojima Y, Hayashi Y, Mizuno K, Sasaki S, Fukui Y, Koopman P, Morohashi K & Kohri K. Up-regulation of SOX9 in human sex-determining region on the Y chromosome (SRY)-negative XX males. Clinical Endocrinology 2008 68 791 799. 3 Vorona E, Zitzmann M, Gromoll J, Schuring AN & Nieschlag E. Clinical, endocrinological, and epigenetic features of the 46,XX male syndrome, compared with 47,XXY Klinefelter patients. Journal of Clinical Endocrinology and Metabolism 2007 92 3458 3465. 4 Van Assche E, Bonduelle M, Tournaye H, Joris H, Verheyen G, Devroey P, Van Steirteghem A & Liebaers I. Cytogenetics of infertile men. Human Reproduction 1996 11 1 24 (discussion 25-6).

EUROPEAN JOURNAL OF ENDOCRINOLOGY (2010) 162 5 Minks J, Robinson WP & Brown CJ. A skewed view of X chromosome inactivation. Journal of Clinical Investigation 2008 118 20 23. 6 Lanfranco F, Kamischke A, Zitzmann M & Nieschlag E. Klinefelter s syndrome. Lancet 2004 364 273 283. 7 Aksglaede L, Wikstrom AM, Rajpert-De Meyts E, Dunkel L, Skakkebaek NE & Juul A. Natural history of seminiferous tubule degeneration in Klinefelter syndrome. Human Reproduction Update 2006 12 39 48. 8 Foresta C, Galeazzi C, Bettella A, Marin P, Rossato M, Garolla A & Ferlin A. Analysis of meiosis in intratesticular germ cells from subjects affected by classic Klinefelter s syndrome. Journal of Clinical Endocrinology and Metabolism 1999 84 3807 3810. 9 Schiff JD, Palermo GD, Veeck LL, Goldstein M, Rosenwaks Z & Schlegel PN. Success of testicular sperm extraction (corrected) and intracytoplasmic sperm injection in men with Klinefelter syndrome. Journal of Clinical Endocrinology and Metabolism 2005 90 6263 6267. 10 Chantot-Bastaraud S, Ravel C & Siffroi JP. Underlying karyotype abnormalities in IVF/ICSI patients. Reproductive Biomedicine Online 2008 16 514 522. 11 Greco E, Iacobelli M, Rienzi L, Fabris GF, Tesorio N & Tesarik J. Birth of a healthy boy after fertilization of cryopreserved oocytes with cryopreserved testicular spermatozoa from a man with nonmosaic Klinefelter syndrome. Fertility and Sterility 2008 89 991.e5 991.e7. 12 Gravholt CH. Epidemiological, endocrine and metabolic features in Turner syndrome. European Journal of Endocrinology 2004 151 657 687. 13 Gravholt CH. Turner syndrome in adulthood. Hormone Research 2005 64 86 93. 14 Clemson CM, McNeil JA, Willard HF & Lawrence JB. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. Journal of Cell Biology 1996 132 259 275. 15 Panning B, Dausman J & Jaenisch R. X chromosome inactivation is mediated by Xist RNA stabilization. Cell 1997 90 907 916. 16 Csankovszki G, Nagy A & Jaenisch R. Synergism of Xist RNA, DNA methylation, and histone hypoacetylation in maintaining X chromosome inactivation. Journal of Cell Biology 2001 153 773 784. 17 Heard E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics & Development 2005 15 482 489. 18 Brown CJ & Greally JM. A stain upon the silence: genes escaping X inactivation. Trends in Genetics 2003 19 432 438. 19 Carrel L & Willard H. X-inactivation profile reveals extensive variability in X-linked gene expression in females. Nature 2005 434 400 404. 20 Panning B & Jaenisch R. DNA hypomethylation can activate Xist expression and silence X-linked genes. Genes and Development 1996 10 1991 2002. 21 Hansen RS & Gartler SM. 5-Azacytidine-induced reactivation of the human X chromosome-linked PGK1 gene is associated with a large region of cytosine demethylation in the 5 0 CpG island. PNAS 1990 87 4174 4178. 22 Matarazzo MR, De Bonis ML, Strazzullo M, Cerase A, Ferraro M, Vastarelli P, Ballestar E, Esteller M, Kudo S & D Esposito M. Multiple binding of methyl-cpg and polycomb proteins in long-term gene silencing events. Journal of Cellular Physiology 2007 210 711 719. 23 Blaschke RJ & Rappold G. The pseudoautosomal regions, SHOX and disease. Current Opinion in Genetics & Development 2006 16 233 239. 24 Loriot A, Boon T & De Smet C. Five new human cancer-germline genes identified among 12 genes expressed in spermatogonia. International Journal of Cancer. Journal International du Cancer 2003 105 371 376. 25 Wang PJ, McCarrey JR, Yang F & Page DC. An abundance of X-linked genes expressed in spermatogonia. Nature Genetics 2001 27 422 426. 26 Vermeulen A, Verdonck L & Kaufman JM. A critical evaluation of simple methods for the estimation of free testosterone in serum. Journal of Clinical Endocrinology and Metabolism 1999 84 3666 3672. 27 Li LC & Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002 18 1427 1431. 28 Song MA, Park JH, Jeong KS, Park DS, Kang MS & Lee S. Quantification of CpG methylation at the 5 0 -region of XIST by pyrosequencing from human serum. Electrophoresis 2007 28 2379 2384. 29 Rajender S, Rajani V, Gupta NJ, Chakravarty B, Singh L & Thangaraj K. SRY-negative 46,XX male with normal genitals, complete masculinization and infertility. Molecular Human Reproduction 2006 12 341 346. 30 Valetto A, Bertini V, Rapalini E & Simi P. A 46,XX SRY-negative man with complete virilization and infertility as the main anomaly. Fertility and Sterility 2005 83 216 219. 31 Aksglaede L, Jorgensen N, Skakkebaek NE & Juul A. Low semen volume in 47 adolescents and adults with 47,XXY Klinefelter or 46,XX male syndrome. International Journal of Andrology 2009 32 376 384. 32 Wutz A & Jaenisch R. A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Molecular Cell 2000 5 695 705. 33 Shibata S, Yokota T & Wutz A. Synergy of Eed and Tsix in the repression of Xist gene and X-chromosome inactivation. EMBO Journal 2008 27 1816 1826. 34 Stabile M, Angelino T, Caiazzo F, Olivieri P, De Marchi N, De Petrocellis L & Orlando P. Fertility in a i(xq) Klinefelter patient: importance of XIST expression level determined by qrt-pcr in ruling out Klinefelter cryptic mosaicism as cause of oligozoospermia. Molecular Human Reproduction 2008 14 635 640. 35 Ross NL, Wadekar R, Lopes A, Dagnall A, Close J, Delisi LE & Crow TJ. Methylation of two Homo sapiens-specific X Y homologous genes in Klinefelter s syndrome (XXY). American Journal of Medical Genetics. Part B, Neuropsychiatric Genetics: the Official Publication of the International Society of Psychiatric Genetics 2006 141B 544 548. 36 Anderson CL & Brown CJ. Variability of X chromosome inactivation: effect on levels of TIMP1 RNA and role of DNA methylation. Human Genetics 2002 110 271 278. 37 Yin S, Wang P, Deng W, Zheng H, Hu L, Hurst LD & Kong X. Dosage compensation on the active X chromosome minimizes transcriptional noise of X-linked genes in mammals. Genome Biology 2009 10 R74. 38 de la Chapelle A. The etiology of maleness in XX men. Human Genetics 1981 58 105 116. 39 Simoni M, Tuttelmann F, Gromoll J & Nieschlag E. Clinical consequences of microdeletions of the Y chromosome: the extended Munster experience. Reproductive Biomedicine Online 2008 16 289 303. Received 1 September 2009 Accepted 6 October 2009 Epigenetics of the X in XX-maleness 175