Validation of a Laboratory Developed Real-Time PCR Protocol for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Urine

Validation of a Laboratory Developed Real-Time PCR Protocol for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Urine Mark J Hopkins, Lynne J Ashton, Fath Alloba, Anura Alawattegama, Ian J Hart To cite this version: Mark J Hopkins, Lynne J Ashton, Fath Alloba, Anura Alawattegama, Ian J Hart. Validation of a Laboratory Developed Real-Time PCR Protocol for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Urine. Sexually Transmitted Infections, BMJ Publishing Group, 2010, 86 (3), pp.207. <10.1136/sti.2009.040634>. <hal-00557463> HAL Id: hal-00557463 https://hal.archives-ouvertes.fr/hal-00557463 Submitted on 19 Jan 2011 HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

1 2 3 Validation of a Laboratory Developed Real-Time PCR Protocol for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Urine 4 5 M J Hopkins, L J Ashton, F Alloba, A Alawattegama, and I J Hart 6 7 8 9 10 11 Authors affiliations M J Hopkins, L J Ashton, I J Hart, Liverpool Specialist Virology Centre, Royal Liverpool University Hospital, Liverpool, UK F Alloba, A Alawattegama, Department of Genitourinary Medicine, Royal Liverpool University Hospital, Liverpool, UK 12 13 14 Correspondence to: M J Hopkins, Liverpool Specialist Virology Centre, Royal Liverpool University Hospital, Liverpool, L7 8XP, UK; m.hopkins@liv.ac.uk 15 16 Running title: Chlamydia and Gonorrhoea Quadruplex Assay 17 18 19 Keywords: Chlamydia trachomatis, Neisseria gonorrhoeae, real-time PCR, laboratory diagnosis, urine 20 1

21 Abbreviations: EQA, external quality assurance; LDA, laboratory developed 22 23 assay; LDQA, laboratory developed quadruplex assay; NAAT, nucleic acid amplification test. 24 25 26 27 28 29 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Sexually Transmitted Infections and any other BMJPGL products to exploit all subsidiary rights, as set out in our licence (http://sextrans.bmj.com/ifora/licence.pdf). 30 2

31 Abstract 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 Objective: To evaluate a sensitive and specific, real-time PCR assay with internal control for Chlamydia trachomatis and Neisseria gonorrhoeae DNA detection in urine specimens. Methods: Diagnostic performance of a laboratory developed quadruplex assay (LDQA) targeting the cryptic plasmid and MOMP genes of C. trachomatis, the pora pseudogene of N. gonorrhoeae, and a synthetic internal control was assessed using 1028 urine specimens. The LDQA was compared to the Roche COBAS Taqman CT test and the COBAS Amplicor NG assay with supplemental confirmation tests. Subsequent performance of the LDQA to detect N. gonorrhoeae was monitored in comparison to bacterial culture from swabs. Results: A total of 88 (8.6%) urines were determined as C. trachomatis positive in the diagnostic evaluation. LDQA sensitivity and specificity were calculated to be 100% and 99.9%, respectively for C. trachomatis. The LDQA showed high specificity with isolates of other Neisseria species and gave complete concordance with resolved data for N. gonorrhoeae detection. However, the incidence of N. gonorrhoeae infection was low with 17 (1.7%) positive patients. A post-implementation audit of 14,316 patients gave the LDQA N. gonorrhoeae urine PCR protocol (pora, OPA, 16s rdna) a sensitivity of 96.9% and specificity of 99.8% in comparison to bacterial culture from swabs. Conclusions: The LDQA was found to be an effective method for detection of C. trachomatis and N. gonorrhoeae DNA in urine samples and the PCR protocol has replaced bacterial culture for screening of N. gonorrhoeae in asymptomatic men and women in our laboratory. 55 3

56 INTRODUCTION 57 58 59 60 61 62 63 64 65 66 Nucleic acid amplification test (NAAT) methodologies are currently recommended as the standard of care for diagnosis of genital chlamydia infection in England. 1 The gold standard method for diagnosis of N. gonorrhoeae infection is bacterial culture, although NAATs are also advocated to increase sensitivity of detection in non-invasive sample types. 2 A number of NAATs for detection of C. trachomatis employ, or are pursuing, multiplex formats to reduce the risk of under-reporting infections, and companies are increasingly offering combined tests capable of detecting both C. trachomatis and N. gonorrhoeae in the same analysis. 3 4 Previous reports have identified problems with the sensitivity of N. gonorrhoeae detection in female urine by PCR and also highlighted the absence of 67 antimicrobial sensitivity data from these tests. 5 However, the relatively small 68 69 70 71 72 73 74 75 76 77 78 79 80 increase in laboratory reagent and labour costs associated with the multiplex format and the ease of non-invasive sexual specimen collection makes this an attractive option for clinics. Different genetic targets are often preferred for screening and confirmation assays to increase the overall specificity of NAAT diagnostic procedures. 1 6 Laboratory developed assays (LDA) can offer useful alternatives to the range of commercial tests, particularly when existing equipment can be utilised and the new protocols aligned to established workflows. However, the laboratory must undertake significant validation of LDA to ensure the assay and method of sample preparation are suitable for diagnostic use. A small number of laboratories in the UK employ LDA for routine screening of C. trachomatis but only limited data is available in the literature for real-time LDAs for the multiplex detection of C. trachomatis and N. gonorrhoeae. 7-9 Here we describe a real-time multiplex LDA 4

81 82 protocol for the detection of C. trachomatis and N. gonorrhoeae and validate its use with first void urine samples. 83 84 85 METHODS Bacterial strains and EQA samples 86 87 88 89 90 91 92 Two external quality assurance (EQA) panels for C. trachomatis and N. gonorrhoeae were supplied by the Quality Control for Molecular Diagnostics (QCMD, Glasgow, UK). PCR specificity for N. gonorrhoeae was also assessed using isolates of N. cinerea (n=16), N. flavescens (n=2), N. gonorrhoeae (n=8), N. lactamica (n=7), N. meningitidis (n=4), N. mucosa (n=1), N. perflava (n=1), N. polysaccharea (n=1), N. sicca (n=3), N. subflava (n=3), and Neisseria spp. (n=7). Patients and specimens 93 94 95 96 97 98 99 100 101 102 103 One thousand and twenty eight urine specimens were obtained from 1,015 patients attending the Genitourinary Medicine Clinic at the Royal Liverpool University Hospital during the period August to October 2007. Median age of the patients was 25 years (range 15 to 73 years) with 556 being male (55%), and 459 female (45%). Samples were collected as part of routine testing for sexually transmitted infections with patient consent obtained to test for both chlamydia and gonorrhoea infection. Patients continued to be swabbed for routine microscopy and N. gonorrhoeae culture for comparison with the N. gonorrhoeae PCR results. Results from the LDQA N. gonorrhoeae PCR protocol were audited in comparison to swabs for bacterial culture over the period February 2008 to February 2009. A total of 14,319 patients were screened during this time. Of 5

104 105 106 these, 3,393 were asymptomatic females, and the remaining 10,926 were symptomatic males and females. DNA isolation 107 108 109 110 111 112 113 114 115 116 117 118 For the LDQA, and the N. gonorrhoeae confirmation assays (NsppID and NG- OPA/16s rdna), genomic DNA was extracted from 500µl of urine or bacterial suspension and eluted in 100µl buffer using the Magnapure Classic automated extraction system with the DNA Isolation Large Volume Kit (Roche Diagnostics, Burgess Hill, UK) according to the manufacturer s instructions. Urine samples (1 ml) were prepared for the C. trachomatis confirmation test (Artus CT Plus assay, Qiagen, Crawley, UK) by centrifugation for 5min at 12 000xg and resuspension of the cell pellet in 400 µl water. The entire volume was then processed using the Qiagen M48 Biorobot and Magattract Virus Mini M48 Kits (Qiagen), eluting in 50 µl buffer. If necessary, extracts were stored at +4 o C for up to 24h or longer term at -70 o C until required. Laboratory developed quadruplex assay 119 120 Neisseria gonorrhoeae assay components were introduced to an established C. trachomatis assay with the best performing quadruplex taken forward for the 121 LDQA. 9-11 Details of the oligonucleotides used in the final assay are given in table 122 123 124 125 126 127 128 1. The assay used LC480 probe master mix (Roche Diagnostics) in accordance with the manufacturer s instructions to a final volume of 25µl, with each reaction containing 10µl purified DNA. Amplification and detection was carried out using a LightCycler 480 PCR machine (Roche Diagnostics) with the following cycling parameters; 5 min at 95 o C, followed by 50 cycles of 10s at 95 o C, 45s at 60 o C, 1s at 72 o C, and a final step of 30s at 40 o C. Amplification signal for the N. gonorrhoeae pora pseudogene fragment or either of the two C. trachomatis PCR 6

129 130 131 targets was taken as a positive result. The internal control was required to amplify in order to call a negative result. COBAS Amplicor/Taqman assays 132 133 134 135 136 137 Samples (500µl) were processed with 50µl of the resultant lysate being used in the Roche COBAS Amplicor NG or Taqman CT assays according to the manufacturer s instructions (Roche Diagnostics). Results from either assay were deemed inhibitory if the internal control failed to amplify in otherwise negative samples. Confirmation PCR assays 138 139 140 141 142 143 144 145 146 147 148 149 150 All urine samples identified as positive or inhibitory for C. trachomatis by the COBAS Taqman CT assay or LDQA were repeat tested with the Artus CT Plus PCR kit (Qiagen Ltd) on a LightCycler 1.2 PCR machine (Roche Diagnostics) according to the manufacturer s instructions. Published PCRs directed toward the neisseria 16S rrna gene (NSppID), and the opacity protein gene (NG-OPA) were used to confirm the presence of N. gonorrhoeae DNA in any sample identified as 12 13 positive, inhibitory or grey zone by the COBAS Amplicor NG test or LDQA. The NSppID assay was run as described previously but was later replaced with the NG-OPA PCR multiplexed with a 16s rdna PCR for post-implementation confirmation of the LDQA (Table 1). The NG-OPA/16s rdna duplex PCR was run on the LC480 under the same conditions as the LDQA but the extension time at 72 o C was increased to 10s. Bacterial culture 151 152 Neisseria gonorrhoeae was isolated using GC agar base with VCAT selective supplement (Oxoid, Basingstoke, UK). Suspect colonies were identified to species 7

153 154 155 level on the basis of Gram stain, oxidase test, Phadebact GC kit (Launch Diagnostics, Longfield, UK) and API NH test (BioMerieux, Basingstoke, UK). Statistical analysis 156 157 158 159 160 Kappa analysis was used to calculate the level of agreement between LDQA for detection of C. trachomatis and/or N. gonorrhoeae in comparison to resolved data from both screening assays and all confirmation tests. Level of agreement was also calculated for confirmed N. gonorrhoeae PCR results against bacterial culture. 161 162 163 RESULTS Assay sensitivity and specificity 164 165 166 167 168 169 170 171 172 173 174 The LDQA scored full marks on the C. trachomatis and N. gonorrhoeae EQA panels, correctly identifying all positive samples and giving no false positive results. The COBAS tests achieved a score of 10/10 for the C. trachomatis EQA panel but falsely identified a sample containing N. lactamica as N. gonorrhoeae positive in the N. gonorrhoeae panel. However, the NsppID confirmation assay differentiated this as a non-gonococcal neisseria positive sample on the basis of melt temperature (66 o C). Neither the COBAS NG Amplicor test nor the N. gonorrhoeae pora component of the LDQA amplified any non-gonococcal isolates from the laboratory panel of 53 Neisseria species but correctly identified the eight isolates of N. gonorrhoeae. Diagnostic evaluation 175 176 Positive urines were identified on the basis of at least two positive results - either two PCRs or PCR with microscopy or culture. Two samples were excluded from 8

177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 the C. trachomatis kappa analysis due to repeatedly inhibitory results with both the COBAS and Artus PCR tests. Table 2 shows resolved data identified 88/1026 (8.6%) C. trachomatis positive samples and gave good concordance with LDQA results (kappa value, 0.99). Both the COBAS CT Taqman and the LDQA screen each identified one false positive C. trachomatis sample. The LDQA correctly detected C. trachomatis DNA in two samples that gave negative results from the COBAS Taqman CT screen (Table 3). Overall, the sensitivity and specificity of the LDQA C. trachomatis screen were calculated to be 88/88 (100%) and 937/938 (99.9%), respectively. The LDQA identified seventeen (1.7%) of the 1028 urine samples as pora pseudogene PCR positive which gave 100% concordance with resolved N. gonorrhoeae data (Table 2). All 17 samples were confirmed as NG-OPA PCR positive but four could not be amplified using the NsppID 16s rdna assay (Table 4). The COBAS Amplicor NG PCR identified a larger number of urine samples that required N. gonorrhoeae confirmation tests with a total of 45/1028 giving a positive (n=19), grey zone (n=6), or inhibitory (n=20) result with this screening assay. Seventeen were the resolved N. gonorrhoeae positives but twenty four could not be confirmed by any of the other tests employed (Table 4). The remaining four were identified as non-gonoccocal Neisseria spp. on the basis of NsppID PCR melt curve analysis. Sensitivity and specificity of the LDQA N. gonorrhoeae screen were calculated as 17/17 (100%) and as 1011/1011 (100%), respectively using this data set. Three (0.3%) of the 1028 samples were confirmed positive for dual infection of C. trachomatis and N. gonorrhoeae. 9

201 Neisseria gonorrhoeae follow-up audit 202 203 204 205 206 207 208 209 210 211 212 213 The LDQA was introduced into routine service in addition to the existing bacterial culture and results from the two techniques were reviewed after 12 months. Kappa analysis of the N. gonorrhoeae urine PCR protocol results showed a strong correlation with bacterial culture (kappa value, 0.99) identifying 210 patients positive by all three PCR targets (pora, OPA, 16s rdna). Twenty five of these were negative by bacterial culture whilst there were an additional six falsenegative PCR results (Table 5). Sensitivity and specificity of the N. gonorrhoeae urine PCR protocol were calculated as 96.9% and 99.8%, respectively using this data set. Gonorrhoea infection was diagnosed in 11 of 3,393 asymptomatic females. One case was culture positive/pcr negative but two cases which were initially negative by bacterial culture from cervical swabs were PCR positive. The latter two cases were culture positive on patient recall. 214 215 DISCUSSION 216 217 218 219 220 221 222 223 224 225 The use of NAATs for detection of C. trachomatis is well established and is increasingly utilised for detection of N. gonorrhoeae, particularly as emphasis shifts towards the use of non-invasive specimen types. 1 14 15 Several manufacturers now supply NAAT platforms that can screen urine samples for both C. trachomatis and N. gonorrhoeae in the same reaction. Results presented here show the LDQA is a sensitive and specific test for detection of C. trachomatis and N. gonorrhoeae in first void urine samples. Dean et. al. (2008) reported the COBAS Amplicor CT test to have a sensitivity and specificity of 96.9% and 98.2% respectively, but there are no published data available comparing the COBAS TaqMan CT test (used in our evaluation) to the Aptima Combo 2 which was cited 10

226 227 as the most sensitive assay in that study. 16 Both Roche and Abbott have included secondary chlamydial targets in their assays to facilitate detection of new variant 228 strains. 8 The LDQA detects the cryptic plasmid and MOMP PCR products in 229 230 231 232 233 234 235 236 different channels of the real-time PCR machine which facilitates local monitoring of this issue. Numerous genetic targets have been assessed for the detection of N. gonorrhoeae although bacterial culture is often considered the diagnostic standard due to genetic heterogeneity in this organism. 9 17-20 If requested, the LDQA allows flexible detection of C. trachomatis and/or N. gonorrhoeae through addition of a pora pseudogene target to the assay. This PCR was chosen because of the high sensitivity and specificity previously demonstrated with the 237 10 21 pseudogene target. The pora PCR was found to be more sensitive and 238 239 240 241 242 243 244 245 246 247 248 249 250 251 specific than the COBAS Amplicor NG test which has previously been shown to generate a considerable number of inhibitory or reactive results that could not be confirmed, and our findings support this (Table 4). The NSppID assay has been reported as a useful confirmation test to improve the specificity of the COBAS NG assay. 12 However, NSppID assay sensitivity was limited in comparison to the NG- OPA confirmation PCR and an NG-OPA/16s rdna duplex assay was subsequently adopted as the confirmation assay to complement the LDQA (pora) screen. Insufficient data for N. gonorrhoeae infection was generated from the initial diagnostic evaluation due to the low prevalence of this organism in our patient population. The LDQA screen was implemented alongside the existing bacterial culture service and a 12 month review of data showed the urine PCR protocol was comparable to N. gonorrhoeae culture from swabs. Although culture was taken as the standard for comparison, the authors feel the 25 culture negative/urine PCR 11

252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 positives (Table 5) could equally be true positives since amplification of all three N. gonorrhoeae targets in the screen and confirmation PCRs (pora, OPA, 16s rdna) was required for a N. gonorrhoeae PCR positive result to be issued. This assumption would improve the performance characteristics of the N. gonorrhoeae urine PCR protocol, although further comparison with additional testing protocols would be needed to establish this. No obvious problems were observed identifying gonorrhoea infection in the 3,393 asymptomatic females tested over this time period. This may be related in part to the use of a nucleic acid purification technique in this protocol to concentrate DNA and efficiently remove inhibitors, unlike the original COBAS method which relied on a simple lysis procedure for sample preparation. Review of this data led to a change of policy in our clinic, with the urine PCR protocol becoming the favoured screen over bacterial culture from swabs for asymptomatic patients. However, antibiotic resistance profiling remains an important consideration and N. gonorrhoeae culture is maintained as part of the confirmation protocol. The authors do not advocate LDA above validated assays from commercial companies which supply support and a degree of accountability, but firmly believe they warrant consideration by specialist molecular diagnostic laboratories when IVD approved tests are not appropriate for existing workflows. Data presented here may be useful to inform laboratory decisions on screening or confirmation protocols, or clinical choice of sample. Key messages This study has validated the C. trachomatis assay previously described by Jalal et al., (2007) for use with first void urine specimens. 7 12

276 277 278 279 280 LDQA followed by NG-OPA/16s rdna PCR confirmation allowed for the specific and sensitive multiplex detection of gonorrhoea infection from a non-invasive sample. Laboratories may find this NAAT data useful when reviewing their existing C. trachomatis and N. gonorrhoeae workflows. 281 282 283 284 285 286 287 288 289 ACKNOWLEDGEMENTS The authors are grateful to Dr Helen Palmer, Scottish Bacterial Sexually Transmitted Infections Reference Laboratory, Royal Infirmary of Edinburgh, UK for provision of Neisseria strains, and to Dr Steven Lane, Centre for Medical Statistics and Health Evaluation, University of Liverpool, for statistical advice throughout this study. The authors thank Mrs Jean Howell in the Department of Genitourinary Medicine, Royal Liverpool University Hospital for assistance compiling the N. gonorrhoeae data. 290 291 292 293 294 CONTRIBUTORS IJH and MJH conceived and designed the evaluation. FA and AA coordinated specimen collection and NG audit. MJH and LJA conducted the PCRs and analysed the data. MJH wrote the manuscript in collaboration with all co-authors. 295 296 Competing interest: None declared. 297 298 Word count (abstract 244, body 2484); Text pages = 20; Tables = 5 299 13

Table 1. Oligonucleotide primers and probes used in this evaluation. Assay Oligonucleotide Sequence (5 to 3 ) Concentration (µm) Target gene Citation LDQA HJ-Cp-F AACCAAGGTCGATGTGATAG 0.25 C. trachomatis HJ-Cp-R TCAGATAATTGGCGATTCTT 0.25 cryptic plasmid HJ-Cp-FAM (FAM) CGAACTCATCGGCGATAAGG (BHQ1) 0.10 HJ-Momp-F GACTTTGTTTTCGACCGTGTT 0.25 C. trachomatis HJ-Momp-R ACARAATACATCAAARCGATCCCA 0.25 MOMP HJ-Momp-VIC (VIC) ATGTTTACVAAYGCYGCTT (MGB-NFQ) 0.10 Pap-Tm-F CAGCATTCAATTTGTTCCGAGTC 0.25 N. gonorrhoeae Pap-Tm-R GAACTGGTTTCATCTGATTACTTTCCA 0.25 pora Pap-Tm-LC610 (LC610) CGCCTATACGCCTGCTACTTTCACGC (BBQ) 0.10 HJ-Ic-F GTGCTCACACCAGTTGCCGC 0.10 Synthetic HJ-Ic-R GCTTGGCAGCTCGCATCTCG 0.10 internal control HJ-Ic-Cy5 (Cy5) ATTGTGTGGGTGTGGTGTGGGTGTGTGC (BHQ3) 0.10 -------------------- ----------------------------------------------------------------------------------- ----------- ---------------- NsppID NG767-F AAAGCGTGGGTAGCAA 1.0 Neisseria spp. NG946-R TTCTTCGCGTTGCATC 5.0 16S rdna NG839-FL CAACCTGATTGCTTAGTAGCGTAGCTAACG (FL) 0.2 NG870-640 (LC640) GTGAAATTGACCGCCTGGGGAGTACGG (PH) 0.4 -------------------- ----------------------------------------------------------------------------------- ----------- ---------------- NG-OPA OPA-F TTGAAACACCGCCCGGAA 0.16 N. gonorrhoeae / 16s OPA-R TTTCGGCTCCTTATTCGGTTTAA 0.16 opa Duplex OPA-Cyan500 (Cyan500) CCGATATAATC+CGTC+CTTCAA+CATCAG (BBQ) 0.16 16s-19-F TCGGACGGCAGCACAGGGAA 0.32 N. gonorrhoeae this 16s-432-R GGCCGCCGATATTGGCAACG 0.32 16S rdna study 16s-88-FAM (FAM) TACCGGGTAGCGGG (MGB-NFQ) 0.16 + denotes position of locked nucleic acid bases. 11 11 9 11 12 13 14

Table 2. LDQA results in comparison to resolved data from 1028 urines for Chlamydia trachomatis and Neisseria gonorrhoeae. C. trachomatis Results N. gonorrhoeae Results LDQA CT Result LDQA NG Result Positive Negative Positive Negative Resolved CT Result Positive 88 0 88 Positive 17 0 17 Resolved NG Result Negative 1 937 938 Negative 0 1011 1011 89 937 1026 a 17 1011 1028 a, Two samples were excluded due to repeatedly inhibitory COBAS and Artus results. LDQA C. trachomatis sensitivity 100%, specificity 99.9%, kappa value 0.99, PPV 98.9%, NPV 100%. LDQA N. gonorrhoeae sensitivity 100%, specificity 100%, kappa value 1.00, PPV 100%, NPV 100%. 15

Table 3. Details of C. trachomatis test results for the 13 discordant specimens. Results for all other specimens were concordant. Resolved results were used in LDQA kappa analysis. LDQA screen COBAS screen Additional tests Number of LDQA CT: LDQA CT: COBAS CT Taqman: Artus CT Plus: Resolved Specimens cryptic plasmid MOMP LDQA CT result cryptic plasmid cryptic plasmid & MOMP CT Result (# female) (CP range) (CP range) (CP range) 1 (0) >45 - CT DNA detected - Inhibitory - 2 (1) 34 42 36 39 CT DNA detected - 33 36 CT Positive 1 (0) - - - CT DNA detected Inhibitory - 1 (1) 43 - CT DNA detected CT DNA detected - CT Positive 1 (1) 41 - CT DNA detected Inhibitory 37 CT Positive 1 (0) 39 40 CT DNA detected CT DNA detected - CT Positive 4 (1) 36 40 - CT DNA detected CT DNA detected 34 37 CT Positive 2 (0) - - - Inhibitory Inhibitory Unclear a Total 13 (4) -, Negative; CP, real-time PCR crossing point; CT, C. trachomatis. a Two samples were excluded from the CT kappa analysis due to repeatedly inhibitory results. Results for the remaining 79 CT resolved positives were concordant. 16

Table 4. Details of N. gonorrhoeae test results for the 34 discordant specimens. Results for all other specimens were concordant. Resolved results were used in LDQA kappa analysis. LDQA screen COBAS screen Additional tests Number of LDQA NG: COBAS NG Amplicor b : NSppID: NG-OPA: NG culture Resolved Specimens pora LDQA NG result methyltransferase 16s rdna opa NG Result (# female) (CP range) (Melt temp) c (CP range) 3 (3) - - Grey zone - - - - 3 (3) - - Grey zone 56 o C, 65 o C - - - 18 (9) - - Inhibitory - - - - 1 (0) 22 NG DNA detected Inhibitory - 22 - d NG Positive 1 (0) 25 NG DNA detected Inhibitory 60 o C 23 - d NG Positive 1 (0) 23 NG DNA detected Inhibitory 60 o C 23 NG isolated NG Positive 3 (3) 28 40 NG DNA detected NG DNA detected - 28 38 NG isolated NG Positive 3 (2) - - NG DNA detected - - - - 1 (1) - - NG DNA detected 65 o C - - - Total 34 (21) -, Negative; CP, real-time PCR crossing point; NG, N. gonorrhoeae. b COBAS NG Amplicor defined grey zone results as OD between 0.300 to 0.999 and positive results if OD 1.000. COBAS CT Taqman does not give grey zone results. c N. gonorrhoeae was defined by a melt temperature of 60 o C. Melt temperatures other than 60 o C were indicative of other Neisseria spp. d N. gonorrhoeae not isolated but Gram-negative diplococci were observed when cells were stained directly from the specimen swab. Results for the remaining 11 NG resolved positives were concordant. 17

Table 5. Neisseria gonorrhoeae urine PCR protocol validation results in comparison to bacterial culture data from14,319 sexual health screens. N. gonorrhoeae Results Urine PCR Protocol Result Positive Negative Bacterial Culture Result Positive 185 6 191 Negative 25 14,100 14,125 210 14,106 14,316 N. gonorrhoeae urine PCR protocol sensitivity 96.7%, specificity 99.8%, kappa value 0.99, PPV 88.1%, NPV 100%. 18

REFERENCES 1 Skidmore S, Horner P, Mallinson H. Testing specimens for Chlamydia trachomatis. Sex Transm Infect 2006;82:272-5. 2 Bignell C. National guideline on the diagnosis and treatment of gonorrhoea in Adults 2005. British Association of Sexual Health and HIV. Available at:http://www.bashh.org/documents/116/116.pdf 3 Levett PN, Brandt K, Olenius K, et al. Evaluation of three automated nucleic acid amplification systems for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in first-void urine specimens. J Clin Microbiol 2008;46:2109-11. 4 Ripa T, Nilsson P. A variant of Chlamydia trachomatis with deletion in cryptic plasmid: implications for use of PCR diagnostic tests. Euro Surveill 2006;11:3076. 5 Cook RL, Hutchison SL, Ostergaard L, et al. Systematic review: noninvasive testing for Chlamydia trachomatis and Neisseria gonorrhoeae. Ann Intern Med 2005;142:914-25. 6 Whiley DM, Tapsall JW, Sloots TP. Nucleic acid amplification testing for Neisseria gonorrhoeae: an ongoing challenge. J Mol Diagn 2006;8:3-15. 7 Jalal H, Al-Suwaine A, Stephen H, et al. Comparative performance of the Roche COBAS Amplicor assay and an in-house real-time PCR assay for diagnosis of Chlamydia trachomatis infection. J Med Microbiol 2007;56:320-2. 8 Unemo M, Rossouw A, James V, et al. Can the Swedish new variant of Chlamydia trachomatis (nvct) be detected by UK NEQAS participants from seventeen European countries and five additional countries/regions in 2009? Euro Surveill 2009;14:19206. 9 Whiley DM, Sloots TP. Comparison of three in-house multiplex PCR assays for the detection of Neisseria gonorrhoeae and Chlamydia trachomatis using real-time and conventional detection methodologies. Pathology 2005;37:364-70. 10 Hjelmevoll SO, Olsen ME, Sollid JU, et al. A fast real-time polymerase chain reaction method for sensitive and specific detection of the Neisseria gonorrhoeae pora pseudogene. J Mol Diagn 2006;8:574-81. 11 Jalal H, Stephen H, Curran MD, et al. Development and validation of a rotorgene real-time PCR assay for detection, identification, and quantification of Chlamydia trachomatis in a single reaction. J Clin Microbiol 2006;44:206-13. 19

12 Mangold KA, Regner M, Tajuddin M, et al. Neisseria species identification assay for the confirmation of Neisseria gonorrhoeae-positive results of the COBAS Amplicor PCR. J Clin Microbiol 2007;45:1403-9. 13 Tabrizi SN, Chen S, Tapsall J, et al. Evaluation of opa-based real-time PCR for detection of Neisseria gonorrhoeae. Sex Transm Dis 2005;32:199-202. 14 Alloba F, Alawattegama A, Jones C. Use of nucleic acid amplification tests for the detection of Neisseria gonorrhoeae: survey of genitourinary medicine clinics in England. Int J STD AIDS 2007;18:652-3. 15 Spigarelli MG. Urine gonococcal/chlamydia testing in adolescents. Curr Opin Obstet Gynecol 2006;18:498-502. 16 Dean L, Perry K, Arnold E et al. Report 06054: Four NAATs for Chlamydia trachomatis in urine specimens. NHS Purchasing and Supply Agency 2008. Available at: http://www.pasa.nhs.uk/pasa/doc.aspx?path=%5bmn%5d%5b SP%5d/NHSprocurement/CEP/Micorbiology/Report06054.pdf 17 Bruisten SM, Noordhoek GT, van den Brule AJ, et al. Multicenter validation of the cppb gene as a PCR target for detection of Neisseria gonorrhoeae. J Clin Microbiol 2004;42:4332-4. 18 Chui L, Chiu T, Kakulphimp J, et al. A comparison of three real-time PCR assays for the confirmation of Neisseria gonorrhoeae following detection of N. gonorrhoeae using Roche COBAS AMPLICOR. Clin Microbiol Infect 2008;14:473-9. 19 Geraats-Peters CW, Brouwers M, Schneeberger PM, et al. Specific and sensitive detection of Neisseria gonorrhoeae in clinical specimens by realtime PCR. J Clin Microbiol 2005;43:5653-9. 20 Palmer HM, Mallinson H, Wood RL, et al. Evaluation of the specificities of five DNA amplification methods for the detection of Neisseria gonorrhoeae. J Clin Microbiol 2003;41:835-7. 21 Whiley DM, Buda PP, Freeman K, et al. A real-time PCR assay for the detection of Neisseria gonorrhoeae in genital and extragenital specimens. Diagn Microbiol Infect Dis 2005;52:1-5. 20