JOURNAL OF VIROLOGY, Sept. 1994, p. 6069-6073 Vol. 68, No. 9 0022-538X/94/$04.00+0 Copyright 1994, American Society for Microbiology Isolation of Epstein-Barr Virus (EBV)-Negative Cell Clones from the EBV-Positive Burkitt's Lymphoma (BL) Line Akata: Malignant Phenotypes of BL Cells Are Dependent on EBV NORIO SHIMIZU, AKIKO TANABE-TOCHIKURA, YASUYUKI KUROIWA, AND KENZO TAKADA* Department of Virology and Parasitology, Yamaguchi University School of Medicine, Kogushi, Ube, Yamaguchi 755, Japan Received 29 March 1994/Accepted 16 June 1994 During cultivation of the Epstein-Barr virus (EBV)-positive Burkitt's lymphoma (BL) line Akata, it was noted that EBV DNA is lost from some of the cells. Isolation of EBV-positive and EBV-negative clones with the same origin made it possible to examine the effects of EBV in BL cells. The results indicate that malignant phenotypes of BL, such as growth in low serum, anchorage-independent growth in soft agar, and tumorigenicity in nude mice, are dependent on the presence of EBV genomes and underline the oncogenic function of EBV in human cancer. Epstein-Barr virus (EBV), a human herpesvirus, is associated with more than 90% of Burkitt's lymphoma (BL) in the African regions of endemicity and less frequently (15 to 20%) with the sporadic BL occurring worldwide. The most consistent finding in BL, whether EBV-infected or not, is a chromosome translocation involving immunoglobulin (Ig) and myc genes. The translocation results in deregulation of c-myc expression and is regarded as the important step in the genesis of BL (2, 11). On the other hand, the role of EBV is still obscure. EBV infects primary B lymphocytes in vitro and transforms them into blasts that can proliferate indefinitely. Such EBV-transformed lymphoblastoid cells maintain the entire viral genome mostly in a plasmid form and express a limited number of virus-encoded proteins, including six nuclear antigens (EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C, and EBNALP) and three membrane proteins (LMP1, LMP2A, and LMP2B), which must play roles in initiation and maintenance of transformation (7). However, in BL cells there is repression of the latent genes, except EBNA1 (17). These observations indicate that the functions of EBV that are required for transformation of primary lymphocytes are not necessary in the maintenance and propagation of BL cells, although these functions may be important during BL genesis. It is not known whether EBV contributes to the growth of the EBV-carrying BL that only expresses EBNA1. The Akata cell line is derived from an EBV-positive BL from a Japanese patient, has a BL-type chromosome translocation, t(8;14), and expresses surface Ig of the G(K) class (21). The Akata line is now commonly used to study reactivation of latent EBV because of its rapid and efficient response to cross-linking of cell surface Ig, using antibody to Ig (anti-ig) (20, 23). The Akata line retains the tumor phenotype, which is characterized by selective expression of EBNA1, in vitro (17). During cultivation of Akata cells, we have noted that EBV DNA is lost from some of the cells. Isolation of EBV-positive and EBV-negative Akata cell clones with the same origin made it possible to examine the effects of EBV in BL cells. The results indicate that malignant phenotypes of BL, such as * Corresponding author. Department of Virology and Parasitology, Yamaguchi University School of Medicine, Kogushi, Ube, Yamaguchi 755, Japan. Phone: 836-22-2341. Fax: 836-22-2237. 6069 growth in low serum, anchorage-independent growth in soft agar, and tumorigenicity in nude mice, are dependent on the presence of EBV genomes and underline the oncogenic function of EBV in human cancer. Initially, Akata cells were virtually 100% positive for EBNA (21). However, after serial passage for about 2 years, we found that 49% of the cells were negative for EBNA as indicated by anticomplement immunofluorescence (21) with a polyvalent human antiserum. Therefore, we intended to isolate EBNApositive and EBNA-negative clones of Akata cells. Akata cells were plated into 96-well plates at 0.5 cell per well and 0.2 ml of conditioned medium per well. The conditioned medium was an equal mixture of fresh RPMI 1640 medium supplemented with 20% fetal calf serum (FCS) (HyClone) and culture supernatant of Akata cells that were suspended in RPMI 1640 medium with 10% FCS at a concentration of 5 x 105 cells per ml and incubated for 3 days. Cells were fed every 4 days with conditioned medium. Three to four weeks later, cell clones emerged in 18% of the wells. Forty-two clones were expanded in fresh RPMI 1640 medium supplemented with 10% FCS and assayed for EBNA expression. As a result, 18 clones were virtually 100% positive for EBNA, 16 clones were completely negative, and 8 clones were a mixture of EBNA-positive and EBNAnegative cells. Representative EBNA-positive and EBNA-negative clones were further examined for the expression of EBNA polypeptides by immunoblot analysis (22). Cell pellets were mixed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis loading buffer. After the pellets were boiled for 5 min, equal amounts of protein (corresponding to 2.5 x 105 cells) were separated in polyacrylamide gels (gradient, 4 to 20%) and transferred to nitrocellulose. The blots were blocked with 5% milk in phosphate-buffered saline. After immunostaining, the blots were developed by the enhanced chemiluminescence (ECL) method (Amersham) according to the manufacturer's instructions. The results are shown in Fig. 1A and B. Parental Akata cells and EBNA-positive clones were positive for EBNA1 polypeptide, while EBNA-negative clones were not. Further examination, by Southern blot and PCR analysis, was carried out to determine whether EBNA-negative clones contain EBV DNA. For Southern blot analysis (22), cellular DNAs (10 plg each) were digested with BamHI endonuclease, electrophoresed on 0.8% horizontal agarose gels, and trans-
6070 NOTES A B C 97-66 - 97-66 - 45-10 11 m < E2 * E1 10 11 BamHl K -* s - - D E 1 239 bp - E2 203 bp L 434 bp 10 11 12 go N. * E2 - L FIG. 1. Detection of EBV latent proteins and genomes in EBNApositive and EBNA-negative clones of Akata cells. (A and B) Immunoblot analysis (22) of protein extracts from an EBV-negative B cell line, BJAB (8) (lane 1), its B95-8 EBV-converted cell line BJAB-B95-8 (lane 2), the parental Akata cell line (lane 3), EBNA-positive Akata cell clones (lanes 4 to 7), and EBNA-negative Akata cell clones (lanes 8 to 11). For immunostaining, blot A was treated with a standard EBNA-positive human serum and peroxidase-labeled protein A. Blot B was treated with anti-ebna2 and anti-lmp1 monoclonal antibodies (16, 26) and peroxidase-labeled anti-mouse antibody. Size markers in kilodaltons are indicated on the left. EBNA1 (El), EBNA2 (E2), and LMP1 (L) bands are indicated by arrows. (C) Southern blot analysis (22) of EBV genomes probed with the BamHI K fragment of EBV DNA. Lanes: 1, parental Akata line; 2 to 5, EBNA-positive Akata cell clones; 6 to 9, EBNA-negative Akata cell clones; 10, 2.22 pg of Raji cell (13) DNA, corresponding to 10 EBV copies per cell; 11, 1.11,ug of Raji cell DNA, corresponding to 5 EBV copies per cell; 12, 222 ng of Raji cell DNA, corresponding to 1 EBV copy per cell. The Raji cell line, an African BL line, maintains a stable copy number of EBV genomes (approximately 45 copies per cell [18]) in a latent state. (D) PCR analysis of EBV genomes. Lanes: 1, parental Akata cells; 2 to 5, EBNA-positive Akata cell clones; 6 to 9, EBNA-negative Akata cell clones. The control experiments indicated that this PCR system could detect 1 to 5 EBV copies in the reaction mixture. TABLE 1. Characteristics of Akata cell clones Growth in No. of colonies No. of mice Cell type low se- in agarose/ with tumor rum' 104 cells" (n = 4)' Parental Akata cells + 97 ± 10 1 J. VIROL. EBV-positive clones 19-16 + 158 + 18 1 19-19 + 136 + 11 2 19-33 + 172 + 20 1 19-88 + 144 + 19 0 EBV-negative clones 19-6 - 0 0 19-24 - 0 0 19-27 - 0 0 19-47 - 0 0 " Cells were suspended in RPMI 1640 medium with 0.1I% FCS at 3 x 105 per ml and incubated for 6 days. ' Ten thousand cells were seeded in 3 ml of medium containing 0.33% agarose over 3 ml of medium containing 0.66% agarose in a 60-mm petri dish. After 3 weeks, colonies that contained >100 cells were counted. The results are means + standard errors of four dishes. C Nude BALB/c mice were injected subcutaneously with 2 x 107 cells per site. Animals were observed up to 8 weeks for tumors. ferred to nitrocellulose. EBV DNAs were visualized by the ECL direct nucleic acid labeling and detection system (Amersham) according to the manufacturer's instructions. For PCR analysis, purified cellular DNAs (200 ng, corresponding to 3.2 x 105 cells) were subjected to PCR, with primer pairs specific for EBNA1 (5'GACGAGGGGCCAGGTACAGG3' and 5'G CAGCCAATGCAACTTGGACGTllTTTGG3'), EBNA2 (5' ATAGTCCAGAACCACGGTCC3' and 5'TCTGGCCTTGA GTCTTAGAGG3'), and LMP1 (5'ACGCACTTTlCTCCTCT TTCCCC3' and 5'GAGGGAGTCATCGTGGTGTGT3'). A 50-,lI portion of reaction mixture consisted of 50 mm KCl, 10 mm Tris hydrochloride (ph 8.3), 1.5 mm MgCl2, 50 p.m (each) datp, dctp, dgtp, and dttp, 1 pfm (each) primer, and 2.5 U of Taq polymerase (Cetus). Reaction mixtures were subjected to 30 cycles of denaturation (95 C, 45 s), annealing (56 C, 45 s), and extension (72 C, 75 s). The PCR products (10 pl1 of each) were size separated on 2% agarose gels, transferred to nitrocellulose, and visualized by the ECL 3' oligonucleotide labeling and detection system (Amersham) with antisense oligonucleotides (5'GATGTGTCTGCCTTCTCTCCTA3' for EBNA1, 5'TAATGGCATAGGTGGAATGTTAT3' for EBNA2, and 5'CCTGCTCATCGCTCTCTGGAAT3' for LMP1) as probes. The results are shown in Fig. IC and D. Analysis of Southern blots probed with the BamHI K fragment of EBV DNA and PCR analysis with primer pairs specific for EBNA1, EBNA2, and LMP1 confirmed that EBNA-negative clones do not contain EBV DNA. Since the parental Akata cells were almost 100% positive for EBNA (21), it is most probable that the EBV plasmid was lost from some of the Akata cells during cultivation. To further confirm this possibility, one of the EBV-positive Akata cell clones, clone 19, was maintained in culture. After 6 months, the EBNA positivity decreased from the initial 100% to 83%. Clone 19 was plated into 96-well plates at 0.5 cell per well. After 3 to 4 weeks of incubation, cell clones emerged in 21% of the wells. Ninety clones were expanded and assayed for EBNA expression. Of these, 63 clones were 100% positive, 10 clones were completely negative, and 17 clones were a mixture of EBNA-positive and EBNA-negative cells. PCR analysis confirmed that EBNA-negative clones do not contain EBV
VOL. 68, 1994 NOTES 6071 A EBV - positive clones EBV - negative clones c) c) ci st la x) C) x j ----7,. --T- B Days in culture Days in culture EBV - positive clone EBV - negative clone C 1 2 3 4 5 6 Iw.mqs _ qg <4- E2.<- El _- E 2 _ <~~~~~L FIG. 2. Growth characteristics of EBV-positive and EBV-negative Akata cell clones. (A) Growth curves in medium with 0.1% FCS. (B) Growth in soft agar of an EBV-positive clone (left) and an EBV-negative clone (right). (C) A nude mouse injected with EBV-positive Akata cell clone 19-19 (left). The mouse was injected 4 weeks previously with 2 x 107 cells. Immunoblot analysis shows that nude mouse tumors (from Akata cell clones 19-16, 19-19, and 19-33) consist of EBNA1-positive cells (right). A standard EBNA-positive human serum and monoclonal antibodies for EBNA2 and LMP1 were used for immunostaining. EBNA1 (El), EBNA2 (E2), and LMP1 (L) bands are indicated by arrows. Lanes: 1, BJAB cells; 2, BJAB-B95-8 cells; 3, EBV-positive Akata cell clone 19-19; 4 to 6, nude mouse tumor cells.
6072 NOTES DNA. Both EBV-positive and EBV-negative clones were virtually 100% positive for surface Ig of the G(K) class and possessed chromosome markers characteristic of the parental Akata cells (21), and so they were clearly derived from the Akata cells and not from contaminated unrelated cells. These results indicate that EBV DNA was lost from some of the Akata cells during cultivation. Isolation of EBV-positive and EBV-negative clones with the same origin makes it possible to examine the effects of EBV in BL cells. Growth characteristics of EBV-positive and EBVnegative clones were compared (Table 1). Both clones grew well in medium with 10% FCS and reached the maximum cell density at around 2 x 106 cells per ml. In 0.1% FCS, EBV-positive clones grew at a slightly reduced rate and at 4 days reached the maximum cell density of around 1.3 x 106 cells per ml, while there was no growth of EBV-negative clones (Fig. 2A). Anchorage dependence of cell growth was assayed in 0.33% agarose (SeaPlaque; FMC). In EBV-positive clones, 1 to 1.7% of the cells grew to visible colonies. In contrast, in EBV-negative clones no colony was macroscopically visible (Fig. 2B). These growth differences between EBV-positive and EBV-negative clones in low serum and soft agarose have been stably retained over 6 months of passages in culture. We further assayed tumorigenicity of EBV-positive and EBVnegative clones in nude mice. Of four EBV-positive clones, three produced tumors at the site of inoculation. By 4 weeks, the tumors ranged in size from 0.7 to 2 cm. Tumor cells consisted of EBNA1-positive cells and were negative for EBNA2 and LMPI (Fig. 2C). On the other hand, EBVnegative clones were not tumorigenic in nude mice. These results indicate that malignant phenotypes of EBV-carrying BL, such as growth in low serum, anchorage-independent growth in soft agar, and tumorigenicity in nude mice, are dependent on the presence of EBV genomes and underline the oncogenic function of EBV in human cancer. EBNA1 plays an integral role in the replication of viral plasmids in EBV-infected cells (24, 25). EBNA1 binds to specific sequences within the plasmid origin of replication (orip), localized in the BamHI C fragment of EBV DNA (5, 14). It also regulates the expression of the EBV latent genes (15, 19). It is not known whether or not EBNA1 affects the replication of any cellular origins of DNA synthesis or the expression of any cellular genes. It seems likely, however, that if there are sequences homologous to the EBNA1-binding sequence within cellular DNA, EBNA1 will bind to them and affect DNA replication and/or RNA synthesis. In addition to EBNA1, two small, nonpolyadenylated RNAs known as EBER1 and EBER2 (4, 10) and the transcripts from the BamHI A region of the genome (1, 7) are commonly expressed in BL and EBV-transformed lymphoblastoid cells. These products and/or additional, presently unidentified viral gene products may contribute to malignant phenotypes of BL cells. Most EBV-negative BL lines are susceptible to EBV infection, leading to stable EBV-positive lines (3, 9). This process has permitted the analysis of biologic roles of EBV in clonal cell populations. However, in EBV-negative BL cells, EBV infection, like infection of primary B lymphocytes, invariably results in expression of a full set of latent genes (12). There has been no infection system such as that which produces BL-type gene expression, which is characterized by selective expression of EBNA1. The EBV-positive and EBV-negative Akata cell clones, for the first time, make it possible to study the phenotypic and biochemical roles of EBV in BL cells. This is the first report of loss of EBV DNA from BL cells. Studies of why EBV plasmid DNA is not maintained in some Akata cells are currently being carried out. J. VIROL. We thank B. Sugden (McArdle Laboratory for Cancer Research, Madison, Wis.) for helpful comments on the manuscript. This work was partly supported by grants from the Japanese Ministries of Education, Science, and Culture and of Health and Welfare. REFERENCES 1. Brooks, L. A., A. L. Lear, L. S. Young, and A. B. Rickinson. 1993. Transcripts from the Epstein-Barr virus BamHI A fragment are detectable in all three forms of virus latency. J. Virol. 67:3182-3190. 2. Epstein, M. A., and B. G. Achong. 1979. The relationship of the virus to Burkitt's lymphoma, p. 321-337. In M. A. Epstein and B. G. Achong (ed.), The Epstein-Barr virus. Springer-Verlag, New York. 3. Fresen, K. O., and H. zur Hausen. 1976. Establishment of EBNAexpressing cell lines by infection of Epstein-Barr virus (EBV)- genome-negative human lymphoma cells with different EBV strains. Int. J. Cancer 17:161-166. 4. Howe, J. G., and J. A. Steitz. 1986. Localization of Epstein-Barr virus encoded small RNAs by in situ hybridization. Proc. Natl. Acad. Sci. USA 83:9006-9010. 5. Jones, C. H., S. D. Hayward, and D. R. Rawlins. 1989. Interaction of the lymphocyte-derived Epstein-Barr virus nuclear antigen EBNA-1 with its DNA-binding sites. J. Virol. 63:101-110. 6. Karran, L., Y. Gao, P. R. Smith, and B. E. Griffin. 1992. Expression of a family of complementary-strand transcripts in Epstein- Barr virus-infected cells. Proc. Natl. Acad. Sci. USA 89:8058-8062. 7. Kieff, E., and D. Liebowitz. 1990. Epstein-Barr virus and its replication, p. 1889-1920. In B. N. Fields et al. (ed.), Virology. Raven Press, New York. 8. Klein, G., T. Lindahl, M. Jondal, W. Leibold, J. Menezes, K. Nilsson, and C. Sundstrom. 1974. Continuous lymphoid cell lines with characteristics of B cells (bone marrow-derived), lacking the Epstein-Barr virus genomes and derived from three human lymphomas. Proc. Natl. Acad. Sci. USA 71:3283-3286. 9. Klein, G., B. Sugden, W. Leibold, and J. Menezes. 1974. Infection of EBV-genome negative and positive human lymphoblastoid lines with biologically different preparations of EBV. Intervirology 3:232-244. 10. Lerner, M. R., N. C. Andrews, G. Miller, and J. A. Steitz. 1981. Two small RNAs encoded by Epstein-Barr virus and complexed with protein are precipitated by antibodies from patients with systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA 78:805-809. 11. Miller, G. 1990. Epstein-Barr virus. Biology, pathogenesis, and medical aspects, p. 1921-1958. In B. N. Fields et al. (ed.), Virology. Raven Press, New York. 12. Murray, R. J., L. S. Young, A. Calender, C. D. Gregory, M. Rowe, G. M. Lenoir, and A. B. Rickinson. 1988. Different patterns of Epstein-Barr virus gene expression and of cytotoxic T-cell recognition in B-cell lines infected with transforming (B95.8) or nontransforming (P3HR1) virus strains. J. Virol. 62:894-901. 13. Pulvertaft, R. J. V. 1965. A study of malignant tumors in Nigeria by short term tissue culture. J. Clin. Pathol. 18:261-273. 14. Rawlins, D. R., G. Milman, S. D. Hayward, and G. S. Hayward. 1985. Sequence specific DNA binding of the Epstein-Barr virus nuclear antigen (EBNA-1) to clustered sites in the plasmid maintenance region. Cell 42:859-868. 15. Reisman, D., and B. Sugden. 1986. trans activation of an Epstein- Barr viral transcriptional enhancer by the Epstein-Barr viral nuclear antigen 1. Mol. Cell. Biol. 6:3838-3846. 16. Rowe, M., H. Evans, L. Young, K. Hennessy, E. Kieff, and A. Rickinson. 1986. Monoclonal antibodies to the latent membrane protein of Epstein-Barr virus reveal heterogeneity of the protein and inducible expression in virus-transformed cells. J. Gen. Virol. 68:1575-1586. 17. Rowe, M., D. T. Rowe, C. D. Gregory, L. S. Young, P. J. Farrell, H. Rupani, and A. B. Rickinson. 1987. Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells. EMBO J. 6:2743-2751. 18. Sternas, L., T. Middleton, and B. Sugden. 1990. The average number of molecules of Epstein-Barr nuclear antigen 1 per cell
VOL. 68, 1994 NOTES 6073 does not correlate with the average number of Epstein-Barr virus (EBV) DNA molecules per cell among different clones of EBVimmortalized cells. J. Virol. 64:2407-2410. 19. Sugden, B., and N. Warren. 1989. A promoter of Epstein-Barr virus that can function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection. J. Virol. 63:2644-2649. 20. Takada, K. 1984. Cross-linking of cell surface immunoglobulins induces Epstein-Barr virus in Burkitt lymphoma lines. Int. J. Cancer 33:27-32. 21. Takada, K., K. Horinouchi, Y. Ono, T. Aya, T. Osato, M. Takahashi, and S. Hayasaka. 1991. An Epstein-Barr virus-producer line Akata: establishment of the cell line and analysis of viral DNA. Virus Genes 5:147-156. 22. Takada, K., Z. Ji, S. Fujiwara, N. Shimizu, and A. Tanabe- Tochikura. 1992. Partial elimination of Epstein-Barr virus plasmids from Burkitt's lymphoma cells by transfecting the BZLF1 gene. J. Virol. 66:5590-5593. 23. Takada, K., and Y. Ono. 1989. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63:445-449. 24. Yates, J. L., N. Warren, D. Reisman, and B. Sugden. 1984. A cis-acting element from the Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently infected cells. Proc. Natl. Acad. Sci. USA 81:3806-3810. 25. Yates, J. L., N. Warren, and B. Sugden. 1985. Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature (London) 313:812-815. 26. Young, L. S., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and J. I. Cohen. 1989. N. Engl. J. Med. 321:1080-1085.