A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

Similar documents
Validation & Assay Performance Summary

Supplementary Figure 1

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

A chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K isoform-selective inhibition

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

SUPPLEMENTARY INFORMATION

Samali A Figure S1.

Supplementary Figure 1

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

EGFR Signals to mtor Through PKC and Independently of Akt in Glioma

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

AP VP DLP H&E. p-akt DLP

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Materials for

SUPPLEMENTAL FIGURE LEGENDS

Supplemental information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction

Quantitative PPARγ expression affects the balance between tolerance and immunity

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENT. Materials and methods

Easy50 PI3K Inhibitor Array*

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

SUPPLEMENTARY FIGURE LEGENDS

33VASTVNGATSANNHGEPPS51PADARPR58

Supplemental Data. Beck et al. (2010). Plant Cell /tpc

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Muse Assays for Cell Analysis

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Nature Immunology: doi: /ni.3866

Supplementary Material

ALM301: Allosteric Isoform selective Akt inhibitor

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Leucine Deprivation Reveals a Targetable Liability

Supplementary figure legends

Supplementary Materials and Methods

SUPPLEMENTARY INFORMATION

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

Supplementary Figure 1

Article. Reference. A pharmacological map of the PI3-K family defines a role for p110alpha in insulin signaling. KNIGHT, Zachary A, et al.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Supplementary Materials for

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes


To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

A Kinase Inhibitor Targeted to mtorc1 Drives Regression in Glioblastoma

Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation

gliomas. Fetal brain expected who each low-

Supplementary Figures

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplementary Materials for

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells

RCPA Research Award Final Progress Review

NIH Public Access Author Manuscript Nat Chem Biol. Author manuscript; available in PMC 2010 June 3.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplementary Information and Figure legends

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Supplementary Figure 1

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Combination of PI3K/mTOR Inhibition Demonstrates Efficacy in Human Chordoma

Chapter 2. Aims & Objectives

T H E J O U R N A L O F C E L L B I O L O G Y

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

PI3K/mTOR Dual Inhibitor

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

Supplementary Appendix

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Transcription:

Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William A. Weiss Figure S1. fails to induce targets associated with DNA damage check-points A and B: U87MG cells were treated with (0.5 µm, 24h), exposed to UVC (20 J/m 2 ) or treated with both agents as shown. A: Cells were fixed and stained with antisera against p-γh2ax (red staining) and counterstained with To- Pro-3 iodide (blue). In contrast to cells treated with UVC, control cells and cells treated with showed little activation of p-γh2ax. Scale bar corresponds to 100 µm. B: Lysates were subjected to immunoblot analysis with antisera indicated. UVC treatment resulted in activation of both p53 and p-γh2ax. In contrast, failed to activate either of these DNA check-point markers, either as monotherapy, or when combined with UVC. These data suggest that does not significantly activate DNA-repair dependent check-points associated with increasing the mutation rate. A Control UVC B p-p53(ser15) p53 p-γh2ax(ser139) UVC + H2AX + + +

Figure S2. Flow cytometry using isoform-selective inhibitors of p110α against a glioma cell line U373M glioma cells were treated with isoform-selective inhibitors shown (0.5 µm) or with (10 µm) for 24h. Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle. G 0 G 1 : 52 G 2 M: 17 G 0 G 1 : 59 S: 19 G 2 M: 22 PIK-64 S: 32 PIK-85 G 0 G 1 : 52 S: 34 G 2 M: 13 PIK-90 G 0 G 1 : 60 G 2 M: 10 PIK-93 G 0 G 1 : 50 S: 36 G 2 M: 14 PIK-112 G 0 G 1 : 55 S: 27 G 2 M: 18 G 0 G 1 : 70 S: 22 G 2 M: 8 PIK-124 TGX-115 S: 32 PIK-73 TGX-286 PIK-108 G 0 G 1 : 55 S: 30 PIK-39 S: 32 Rapamycin G 0 G 1 : 48 S: 36

Figure S3. Comparison of isoform-selective inhibition and sirna directed against p110α or p110β U87MG glioma cell lines were treated with isoform-selective inhibitors PIK-90 (p110α) or TGX-286 (p110β) at 0.5 µm, with sirna directed against p110α (Czauderna et al., 2003), p110β (Santa Cruz), or with a control scrambled sirna (Elbashir et al., 2001). A: Lysates were immunoblotted for signaling intermediates shown. Whereas all active agents blocked p- Akt, sirna against p110β was unique in reducing levels of p85α, a result also observed by others interrogating the impact of p110β loss genetically (Brachmann et al., 2005). B: Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle. In contrast to results using small molecule inhibitors of p110β, sirna directed against p110β led to proliferative arrest. Although this arrest could in-part be attributable to decreased levels of p110β, other variables contributing to this arrest include decreased levels of free p85, and alterations in the ratio of p110:p85, both of which are key regulators of PI3-kinase signaling (reviewed in (Hennessy et al., 2005)).

Figure S4. inhibits phosphorylation of Akt in a dose dependent manner, and induces cell cycle arrest in a panel of human glioma cell lines irrespective of p53 or PTEN status A and B: U87MG (PTEN mutant) and LN229 cells (PTEN wild-type) were treated with (0.01-0.5 µm) for 24h. Lysates were subjected to immunoblot analysis with antisera indicated. C and D: Proliferation was visualized by crystal-violet staining of cells after treatment with for 48h (top panels) Cell cycle distribution was analyzed by flow cytometric analysis after treatment for 24h (bottom panels). Percentage of cells in G 0 /G 1, S, and G 2 M phases of the cell cycle are indicated. Although levels of p-akt were increased in the PTEN mutant cell line, both cell lines showed similar dose-response to, irrespective of PTEN status. E: Human glioma cell lines indicated were treated with (0.5 µm) or (10 µm) for 24h. Cells were harvested, lysed and subjected to immunoblot analysis with antisera indicated.

Figure S5. Isoform-selective inhibitors of p110α show activity against a panel of glioma cell lines Glioma cell lines indicated were treated with isoform-selective inhibitors shown (0.5 µm) or with (10 µm) for 24h. Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle.

Table S1. G 0 G 1 arrest in glioma cell lines, irrespective of p53 Cell line U87 P53 status PTEN Treatment or PTEN status Cell Cycle Distribution G 0 G 1 S G 2 M 54 77 80 35 11 14 9 12 8 U87:² EGFR 51 65 71 38 11 29 6 24 5 U87:EGFR U373 LN299 SF188 LN-Z308 A1207 SF763 SF767 48 54 63 46 62 64 51 60 65 33 52 66 36 36 47 27 49 70 31 65 70 44 61 72 36 16 31 15 23 14 38 16 22 16 21 15 24 24 19 20 18 17 44 23 38 10 28 6 52 12 51 13 41 12 42 31 41 10 25 5 41 27 19 19 9 21 32 24 25 13 15 12 Cells were treated with (control), (0.5 µm), or (10 µm) for 24 h. There are no known glioma cell lines that carry gain of function mutations in p110α. The frequency of these mutations in glioma is currently uncertain. Abbreviations;, Wild type;, Mutant.