Journal of Integrative Agriculture 2017, 16(0): 60345-7 Available online at www.sciencedirect.com ScienceDirect RESEARCH ARTICLE The composition of Fusarium species in wheat husks and grains in south-eastern Poland Adam Kuzdraliński 1, Michał Nowak 2, Hubert Szczerba 1, Karolina Dudziak 2, Marta Muszyńska 1, Justyna Leśniowska-Nowak 2 1 Department of Biotechnology, Human Nutrition and Science of Food Commodities, University of Life Sciences in Lublin, Lublin 20-704, Poland 2 Institute of Plant Genetics, Breeding and Biotechnology, University of Life Sciences in Lublin, Lublin 20-950, Poland Abstract Fusarium populations were investigated on 53 samples of wheat grains and husks collected approximately three weeks before harvest in 53 wheat fields in south-eastern Poland. A limited area of sample collection was chosen intentionally to avoid the effect of climate and weather variability. The study was conducted to assess the occurrence of 13 Fusarium species using species-specific PCR assays separately on grains and husks of winter wheat. The obtained data suggest that husks could take a protective role of wheat grain against Fusarium spp. The incidence of Fusarium species decreased in grains vs. husks from 29 to 100%. While Fusarium species were present in husks at 11.32% and less, they were absent in the grain. The presence of Fusarium species on husks is inversely proportional to the percentage reduction of Fusarium spp. in grain. There was a correlation of the presence of certain species of Fusarium in husks and in grains. The number of Fusarium species found on husks was about three times higher in comparison to wheat grain. In conclusion, the presented data indicates the importance of Fusarium populations analysis on wheat husk in seeds pathological studies. Keywords: Fusarium spp., wheat, husks, polymerase chain reaction 1. Introduction Fusarium is one of the most common pathogens attacking crops. This large fungi group infects mostly cereals (wheat, trit icale, oat), but also other plants that are the basis of human and animal nutrition. Fusarium is able to attack a variety of plant organs, such as seedlings, heads, roots or Received 15 August, 2016 Accepted 9 December, 2016 Correspondence Adam Kuzdraliński, Tel: +48-512-294592, Fax: +48-81-4623400, E-mail: adamkuzdralinski@gmail.com 2017, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(16)61552-6 stem-base and causes cereal diseases as, for example, Fusarium head blight (FHB), foot and root rot (FRR) and crown rot (CR) (Nelson et al. 1994; Bentley et al. 2006; Balmas et al. 2015). FHB is responsible for worldwide economic losses estimated at more than billion dollars annually. Yield losses are mostly caused by mycotoxins produced by Fusarium, which leads to a reduction of grain quality and quantity (Parry et al. 1995; Champeil et al. 2004; Wegulo et al. 2015). FRR and CR are also a major problem in wheat production. These diseases induce rotting of seeds, crowns and roots and lead to significant grain yield losses each year (Smiley and Patterson 1996). The reduction of wheat yield caused by CR can even reach 61% (Matny 2014). In E urope, the described crop diseases are mainly caus ed by infections of several Fusarium species as F.
Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 3 culmorum, F. graminearum. F. pseudograminearum, F. poae and F. avenaceum, while F. equiseti, F. langsethiae and F. sporotrichioides are among less commonly isolated species (Bottalico and Perrone 2002; Wagacha and Muthomi 2007; Vogelgsang and Sulyok 2008). Many studies have reported the relationship between the presence of Fusarium species on w inter wheat and climate conditions or crop rotation (Mansfield et al. 2005; Xu et al. 2013; Czembor et al. 2015). However, there is little data referring to the identification of the same Fusarium species both on husks and grains and the correlation between several Fusarium species occurrence in one sample. PCR is a commonly used technique for sensitive and rapid identification of Fusarium species. PCR can be an alternative or a complement to the identification based on morphological characteristics (Demeke et al. 2005; Spanic et al. 2010; Faria et al. 2012; Suga et al. 2013). The most frequently identified species by PCR are F. graminearum and F. culmorum (Kuzdraliński et al. 2014). In addition, there is a number of molecular methods to identify other species of Fusarium, e.g., F. sporotrichioides, F. poae, F. avenaceum, F. proliferatum, F. oxysporum, F. verticillioides, F. equiseti, F. fujikuroi or F. acuminatum (Mishra et al. 2003; Demeke et al. 2005; Amatulli et al. 2010). The aim of the present study was to: (i) identify the species belonging to the genus Fusarium occurring on husks and grains of winter wheat, separately; (ii) determine the reduction level and the correlation between the incidence of Fusarium species on grains vs. husks. 2. Materials and methods 2.1. Sample collection Samp les of winter wheat plants were collected during the 2012/2013 growing season from 53 fields located in south-eastern Poland (mostly in the Lublin Province) (Fig. 1). All ear samples were taken randomly at the BBCH 93-97 wheat growth stage from at least 5 areas of field (5 ears from each area) and mixed together. Sampling from field edges was avoided. Samples were transported to the laboratory and stored at 20 C. 2.2. DNA extraction DNA extraction was performed from 10 wheat ears, ran- Fig. 1 Map of south-eastern Poland (Google Maps Engine Lite; Liebert 2013) showing wheat sampling locations.
4 Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 domly selected from each sample. The grains were separated from husks in each sample and DNA extraction was performed as follows. The subsamples of wheat grains/ husk s (15 25 mg) were transferred to 2 ml Eppendorf tubes and pestled in liquid nitrogen to fine powder. Subsequently, equal weight of grain and husks was taken from each sample. For DNA extraction, the GeneMATRIX Plant & Fu ngi DNA Purification Kit (EURx, Poland) was used acco rding to the manufacturer s instruction. DNA purity and concentration was determined spectrophotometrically (NanoDrop, ThermoScientific, USA). DNA samples were stored at 20 C. 2.3. Fusarium identification using PCR Spec ies-specific primers were used for Fusarium identificati on. Primer sequences, amplicon sizes and reference sources are shown in Table 1. The samples were run in 25 µl reactions using 2 PCR Master Mix (Thermo Scientific Fermentas, Lithuania) with 20 pmol of each primer and 20 ng of DNA. Thermal cycling conditions specific for each primer pair were as follows: After an initial step at 95 C for 5 min, 40 cycles of the following conditions were performed, 95 C for 30 s, 58 C for 30 s and 72 C for 45 s for F. culmorum, F. graminearum, F. sporotrichioides and F. langsethiae; 57 C for 30 s and 72 C for 30 s for F. poae and F. avenaceum; 55 C for 30 s and 72 C for 45 s for F. equiseti; 58 C for 30 s and 72 C for 1 min for F. cerealis; 55 C for 30 s and 72 C for 30 s for F. pseudograminearum; 52 C for 30 s and 72 C for 15 s for F. proliferatum; 59 C for 30 s and 72 C for 30 s for F. venenatum; 60 C for 30 s and 72 C for 30 s for F. subglutinans; 58 C for 30 s and 72 C for 1 min for F. verticillioides. After cycling all reactions were incubated at 72 C for 8 min. Positive controls were obtained from internal Fusarium spp. strains collection of the Department of Biotechnology, Huma n Nutrition and Science of Food Commodities of University of Life Sciences in Lublin. The amplification products were separated by electrophoresis on 1.5% (w/v) agarose gels stained with ethidium bromide in 1 TBE for 1.5 h at 120 V. DNA bands were visu alized using GelDoc 20 Gel Documentation System (BioRad, USA). The size of the products was determined with the GeneRuler 100 bp plus DNA ladder (ThermoScientific Fermentas, Lithuania). 2.4. Data analyses The analyses were carried out to: (i) identify which Fusari um species were present on winter wheat collected in south-eastern Poland (in grains and husks separately and together), (ii) determine the correlation between the occu rrence of Fusarium in grains and husks among the same species, (iii) determine whether there is a correlation between Fusarium species occurrence. The relationships Table 1 Species-specific primers used to identify Fusarium species. Target species Primer name Sequence 5 33 Amplicon size (bp) Reference F. avenaceum J1AF GCTAATTCTTAACTTACTAGGGGCC 220 Turner et al. 1988 J1AR CTGTAATAGGTTATTTACATGGGCG F. culmorum FC01F ATGGTGAACTCGTCGTGGC 570 Nicholson et al. 1998 FC01R CCCTTCTTACGCCAATCTCG F. equiseti FEF1 CATACCTATACGTTGCCTCG 400 Mishra et al. 2003 FER1 TTACCAGTAACGAGGTGTATG F. graminearum Fg16F CTCCGGATATGTTGCGTCAA 450 Nicholson et al. 1988 Fg16R GGTAGGTATCCGACATGGCAA F. poae FP82F FP82R CAAGCAAACAGGCTCTTCACC TGTTCCACCTCAGTGACAGGTT 220 Parry and Nicholson. 1996 F. sporotrichioides AF330109CF AAAAGCCCAAATTGCTGATG 332 Demeke et al. 2005 AF330109CR TGGCATGTTCATTGTCACCT F. pseudograminearum FP1-1 FP1-2 CGGGGTAGTTTCACATTTCYG GAGAATGTGATGASGACAATA 523 Aoki and O'Donnell 1999 F. verticillioides Fps-F CGCACGTATAGATGGACAAG 700 Jurado et al. 2005 Vert2 CACCCGCAGCAATCCATCAG F. proliferatum Fp3-F CGGCCACCAGAGGATGTG 230 Jurado et al. 2005 Fp3-R CAACACGAATCGCTTCCTGAC F. cerealis CRO-AF CRO-AR CTCAGTGTCCACCGCGTTGCGTAG CTCAGTGTCCCATCAAATAGTCC 842 Yoder and Christianson 1998 F. venenatum VEN-BF VEN-BR GGCGGATAAGGATAGTGGTAGAAG GGCGGATAAGCAAATAAGATGCTT 276 Yoder and Christianson 1998 F. subglutinans 61-2P GGCCACTCAAGCGGCGAAAG 445 Möller et al. 1999 61-2R GTCAGACCAGAGCAATGGGC F. langsethiae FlangF3 LanspoR1 CAAAGTTCAGGGCGAAAACT TACAAGAAGACGTGGCGATAT 310 Wilson et al. 2004
Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 5 were statistically analyzed using Spearman correlation coefficient implemented in Statgraphics Centurion XV software (Sat Point, Inc., USA). The significance was assumed at P 0.05 and P 0.001. 3. Results and discussion Fig. 2 compares the percentage of Fusarium species incidence on grains and husks of winter wheat that have been identified by PCR assays. In our experiments, we detected 11 out of 13 studied Fusarium species. However, three of them, i.e., F. cerealis, F. langsethiae and F. verticillioides were identified only on wheat husks, whereas they were not detected on grains. Additionally, F. pseudograminearum was detected on grains, while the presence of this species was not confirmed on husks. F. graminearum, F. avenaceum and F. poae were the most frequent Fusarium species detected on husks and grains. Data analysis reveals that the presence of Fusarium species on husks is inversely proportional to the percentage reduction of Fusarium spp. in grain. Our results indicated that husks might form a barrier for Fusarium and reduce the incidence of these fungi. If we assume the incidence of Fusarium species on husks as 100%, we can compute reducing the presence of Fusarium species on the grains, which reaches from about 29 to 100%. It was also found that when husks were colonized as low as 11.32% or less by Fusarium species, this species was absent in grains. Absence of certain Fusarium species, e.g., F. verticillioides on grain may be caused by pathogen-host interactions. F. verticillioides is the most commonly reported fungal species infecting maize (Nelson et al. 1993). However, Palazzini et al. (2013) showed that wheat stalks were important reservoirs for F. verticillioides. Results suggest that several physical barriers could potentially limit the advance of fungal infection between the husk and the grain (Hope et al. 2005). However, there are reports showing that husks could be an inoculum reservoir for wheat head infections during the growth season and also they are an important part of the crop residues that are known as the principal source of Fusarium spp. (Trenholm et al. 1989). For some species, there was a 2 3 times higher Fusarium incidence on husks in comparison to the grain. This dependence was visible especially when Fusarium species were present on about 25 65% of the husk samples. In agreement with our results, there are reports that the level of Fusarium mycotoxins are higher in husk than that in wheat grain, probably due to the high fungi incidence (Young and Miller 1985; Wang and Miller 1988; Perkowski et al. 1990) and that husk plays an important role in susceptibility to Fusarium infections (Warfield and Davis 1996). The obtained results have shown, on wheat husks, with a weak positive correlation, that the presence of F. avenaceum seemed to be related with the occurrence of F. poae (0.34) as well as the presence of F. culmorum with the occurrence of F. equiseti (0.3) and the presence of F. sporotrichioides with the occurrence of F. langsethiae (0.28) (Fig. 3). In addition, a negative correlation between F. graminearum and F. langsethiae was observed ( 0.39). The interaction between Fusarium species was studied by Kuzdraliński et al. (2014) on stem bases of winter wheat derived from different regions of Poland (eastern, central, south-western and north-western Poland) in 2012. In that study, it was proved that the presence of F. graminearum was related to the presence of F. culmorum (0.324), and the occurrence of F. poae was associated with F. sporotrichioides (0.26) on 120 Incidence in husks Incidence in grains Fusarium incidence reduction husks vs. grains Incidence (%) 100 80 60 40 20 0 F. graminearum 98.11 100.00 100.00 100.00 83.02 69.81 67.92 76.93 47.17 55.55 56.24 43.18 28.85 30.19 30.19 24.53 28.61 13.21 13.21 11.32 11.32 5.66 9.43 0 0 3.77 0 F. avenaceum F. poae F. sporotrichioides F. equiseti F. culmorum F. langsethiae F. verticillioides F. cerealis Fig. 2 Reduction of Fusarium spp. incidence in husks vs. grains, as compared to Fusarium spp. incidence in husks. Fusarium species listed according to incidence percentage in the husks.
6 Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 +0.34 * ** 0.39 +0.28 +0.3 F. langsethiae F. graminearum F. sporotrichioides F. avenaceum F. poae +0.43 F. equiseti +0.28 +0.64 F. culmorum F. poae Husk Grain F. avenaceum F. culmorum * Spearman correlation coefficients ** The width of linker is propotional to correlation coefficients Positive correlation Negative correlation Weak correlation Moderate correlation Strong correlation Very strong correlation 0.2 to 0.39; 0.2 to 0.39 0.4 to 0.59; 0.4 to 0.59 0.6 to 0.79; 0.6 to 0.79 0.8 to 1.0; 0.8 to 1.0 Fig. 3 Spearman correlation coefficients of Fusarium spp. incidence in the grain and husk of winter wheat. The thickness of the line is proportional to the correlation coefficient. stem bases of winter wheat. In this study, a weak correlation was observed on husks between F. culmorum and F. equiseti and between F. graminearum and F. poae. Differences in the correlation between species may suggest that Fusarium spp. composition can be dependent on factors, such as soil or/and atmospheric conditions. This study has indicated that correlations between Fusarium species is not only associated with the same Fusarium section, because correlations on husks between Discolor (F. culmorum) and Gibbosum (F. equiseti), or between Discolor (F. graminearum) and Sporotrichiella (F. poae), are also possible. In the current study, other parts of plants (grains and husks without stem bases) were tested, what could also have contributed to the differences in the results. The majority of interactions observed previously by other authors had a character of growth inhibition, e.g., a negative correlation was found between F. moniliforme and F. graminearum, F. moniliforme and both F. graminearum and F. subglutinans, F. culmorum and Microdochium nivale (formerly F. nivale), F. graminearum and F. proliferatum (Marin et al. 1998; Reid et al. 1999; Simpson et al. 2004). Our data have shown that Fusarium species present on husks interacted, mainly positively, while we have not detected correlations between Fusarium species occurring on grains. The obtained results have shown, that the presence of F. avenaceum, F. poae and F. culmorum on husks is correlated with the occurrence of these species on grain. Interestingly, no interactions between husks and grain was found for other species of Fusarium. This result may be caused by a significant degree of the reduction of the Fusarium population between husks and kernels. Fig. 4 shows the number of Fusarium species on wheat grains and husks. It is possible to observed that three Percent of samples (%) 40 35 30 25 20 15 10 5 0 (37.7%) or four (24.5%) Fusarium species occurred on husks with a relative frequency, while wheat grains were usually infected by one (34%) or two (30.2%) Fusarium species. Over 10% of the grain samples was Fusarium-free, while on husks, all samples had at least one Fusarium species detected. Husks can be classified as an important factor of passive resistance under natural infection conditions (Buerstmayr et al. 2003). 4. Conclusion Grain Husk 0 1 2 3 4 5 6 No. of Fusarium species detected Fig. 4 The number of Fusarium species detected in different samples. The results reported in this work demonstrates the occurrence of Fusarium species in wheat husks and grains and suggestes that husks could be considered as a protective barrier against Fusarium species infection. Interactions between Fusarium species suggest that the husk could be an important factor affecting the formation and development of FHB or other diseases in wheat. In addition, the presented data indicates the importance of Fusarium populations analysis on wheat husk in seeds pathological studies.
Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 7 Acknowledgements This work was supported by the internal funds of University of Life Sciences in Lublin, Poland. References Amatulli M T, Spadaro D, Gullino M L, Garibaldi A. 2010. Molecular identification of Fusarium spp. associated with bakanae disease of rice in Italy and assessment of their pathogenicity. Plant Pathology, 59, 839 844. Aoki T, O Donnell K. 1999. Morphological and molecular characterization of Fusarium pseudograminearum sp. nov., formerly recognized as the group 1 population of F. graminearum. Mycologia, 91, 597 609. Balmas V, Scherm B, Marcello A, Beyer M, Hoffmann L, Migheli Q, Pasquali M. 2015. Fusarium species and chemotypes associated with Fusarium head blight and Fusarium root rot on wheat in Sardinia. Plant Pathology, 64, 972 979. Bentley A R, Cromey M G, Farrokhi-Nejad R, Leslie J F, Summerell B A, Burgess L W. 2006. Fusarium crown and root rot pathogens associated with wheat and grass stem bases on the South Island of New Zeland. Australasian Plant Pathology, 35, 495 502. Bottalico A, Perrone G. 2002. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. European Journal of Plant Pathology, 108, 611 624. Buerstmayr H, Stierschneider M, Steiner B, Lemmens M, Griesser M, Nevo E. 2003. Variation for resistance to head blight caused by Fusarium graminearum in wild emmer (Triticum dicoccoides) originating from Israel. Euphytica, 130, 17 23. Champeil A, Doré T, Fourbet J F. 2004. Fusarium head blight: Epidemiological origin of the effects of cultural practices on head blight attacks and the production of mycotoxins by Fusarium in wheat grains. Plant Science, 166, 1389 1415. Czembor E, Stępień Ł, Waśkiewicz A. 2015. Effect of environmental factors on Fusarium species and associated mycotoxins in maize grain grown in Poland. PLoS ONE, 30, e0133644. Demeke T, Clear R M, Patrick S K, Gaba D. 2005. Speciesspecific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. International Journal of Food Microbiology, 103, 271 284. Faria C B, Abe C A, da Silva C N, Tessmann D J, Barbosa- Tessmann I P. 2012. New PCR assays for the identification of Fusarium verticillioides, Fusarium subglutinans and other species of the Gibberella fujikuroi complex. International Journal of Molecular Sciences, 13, 115 132. Hope R, Aldred D, Magan N. 2005. Comparison of environmental profiles for growth and deoxynivalenol production by Fusarium culmorum and F. graminearum on wheat grain. Letters in Applied Microbiology, 40, 295 300. Jurado M, Vazquez C, Patino B, Gonzalez-Jaen M T. 2005. PCR detection assays for the trichothecene-producing species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides. Systematic and Applied Microbiology, 28, 562 568. Kuzdraliński A, Szczerba H, Tofil K, Filipiak A, Garbarczyk E, Dziadko P, Muszyńska M, Solarska E. 2014. Early PCRbased detection of Fusarium culmorum, F. graminearum, F. sporotrichioides and F. poae on stem bases of winter wheat throughout Poland. European Journal of Plant Pathology, 140, 491 502. Liebert B. 2013. Create, collaborate and share advanced custom maps with Google Maps Engine Lite (Beta). Google Maps. [2016-01-01]. http:// google-latlong. blogspot. com/ 2013/ 03/ create-collaborate-and-share-advanced. html Mansfield M A, De Wolf E D, Kuldau G A. 2005. Relationships betwe en w eather conditions agronomic practi ces, and fermentation characteristics with deoxynivalenol content in fresh and ensiled maize. Plant Disease, 89, 1151 1157. Marin S, Sanchis V, Ramos A J, Vinas I, Mag an N. 1998. Envir onme ntal factors, in v itro interaction s, an d niche overlap between Fusarium moniliforme, F. proliferatum and F. graminearum, Aspergillus and Penicillium species from maize grain. Mycological Research, 102, 831 837. Matny O. 2014. Fusarium head blight and crown rot on wheat & barley: Losses and health risks. Advances in Plants & Agriculture Research, 2, 00039. Mishr a P K, Fox R T V, Culh am A. 2003. Development of PCR-based assay for rapid and reliable identification of pathogenic Fusaria. FEMS Microbiol Letters, 218, 329 332. Möller E M, Chełkowski J, Geiger H H. 1999. Species-specific PCR assays for the fungal pathogens Fusarium moniliforme and Fusarium subglutinans and their application to diagnose maize ear rot disease. Jour nal of Phytopathology, 147, 497 508. Nelson P E, Desjardins A E, Plattner R D. 1993. Fumonisins, mycot oxin s produced by fusarium species: Biology, chemi stry, and significance. Annual Review of Phytopathology, 31, 233 252. Nelso n P E, Dignani M C, Anaissie E J. 1994. Taxonomy, biology, and clinical aspects of Fusarium species. Clinical Microbiology Reviews, 7, 479 504. Nicholson P, Simpson D R, Weston G, Rezanoor H N, Lees A K, Parry D W, Joyce D. 1998. Detection and quantification of Fu sari um culmorum and Fusarium graminearum in cerea ls u sing PCR assays. Physiological and Molecular Plant Pathology, 53, 17 37. Palazzini J M, Groenenboom-de Haas B H, Torres A M, Köhl J, Chulze S N. 2013. Biocontrol and population dynamics of Fu sari um spp. on wheat stubble in Argentina. Plant Pathology, 62, 859 866. O Don nell K, Kistler H C, Cigelnik E, Ploetz R C. 1998. Multiple evolutionary origins of the fungus causing Panama disea se o f banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the Natio nal Academy of Sciences of the United States of
8 Adam Kuzdraliński et al. Journal of Integrative Agriculture 2017, 16(0): 60345-7 America, 95, 2044 2049. Parry D W, Jenkinson P, McLeod L. 1995. Fusarium ear blight (scab) in small grain cereals - A review. Plant Patholology, 44, 207 238. Parry D W, Nicholson P. 1996. Development of a PCR assay to detect Fusarium poae in wheat. Plant Patholology, 45, 383 391. Perkowski J, Chelkowski J, Wakulinski W. 1990. Mycotoxins in ce real grain Part 13. Deoxynivalenol and 3-acetyldeoxy nivalenol in wheat kernels and chaff with head fusariosis symptoms. Molecular Nutrition & Food Research, 34, 325 328. Reid L M, Nicol R W, Ouellet T, Savard M, Miller J D, Young J C, Stewart D W, Schaafsma A W. 1999. Interaction of Fusarium graminearum and F. moniliforme in maize ears: Sisease progr ess, fungal biomass, and mycotoxin accumulation. Phytopathology, 89, 1028 1037. Simpson D R, Thomsett M A, Nicholson P. 2004. Competitive interactions between Microdochium nivale var. majus, M. nivale var. nivale and Fusarium culmorum in planta and in vitro. Environmental Microbiology, 6, 79 87. Smiley R W, Patterson L M. 1996. Pathogenic fungi associated with Fusarium foot rot of winter wheat in semiarid Pacific Northwest USA. Plant Disease, 80, 944 949. Spanic V, Lemmens M, Drezner G. 2010. Morphological and molecular identification of Fusarium species associated with head blight on wheat in East Croatia. European Journal of Plant Pathology, 128, 511 516. Suga H, Hirayama Y, Morishima M, Suzuki T, Kageyama K, Hyaku machi M. 2013. Development of PCR primers to identify Fusarium oxysporum f. sp. fragariae. Plant Disease, 97, 619 625. Trenholm H L, Prelusky D B, Young J C, Miller J D. 1989. A practical guide to the prevention of Fusarium mycotoxins in grain and animal feedstuffs. Archives of Environmental Contamination and Toxicology, 18, 443 451. Turne r A S, Lees A K, Rezanoor H N, Nicholson P. 19 98. Refinement of PCR-detection of Fusarium avena ceum and evidence from DNA marker studies for p henetic relatedness to Fusarium tricinctum. Plant Pathology, 47, 278 288. Vogelgsang S, Sulyok M. 2008. Toxigenicity and pathogenicity of Fu sarium poae and Fusarium avenaceum on wheat. European Journal of Plant Pathology, 122, 265 276. Wagac ha J M, Muthomi J W. 2007. Fusarium culmorum: Infec tion process, mechanisms of mycotoxin production and their role in pathogenesis in wheat. Crop Protection, 26, 877 885. Wang Y Z, Miller J D. 1988. Effects of fusarium graminearum metabolites on wheat tissue in relation to fusarium head blight resistance. Journal of Phytopathology, 122, 118 125. Warfield C Y, Davis R M. 1996. Importance of the husk covering on the susceptibility of corn hybrids to Fusarium ear rot. Plant Disease, 80, 208 210. Wegulo S N, Baenziger P S, Nopsa J H, Bockus W W, Hallen- Adams H. 2015. Management of Fusarium head blight of wheat and barley. Crop Protection, 73, 100 107. Wilson A, Simpson D, Chandler E, Jennings P, Nicholson P. 2004. Development of PCR assays for the detection and differentiation of Fusarium sporotrichioides and Fusarium langsethiae. FEMS Microbiology Letters, 233, 69 76. Xu X, Madden L V, Edwards S G, Doohan F M, Moretti A, Hornok L, Nicholson P, Ritieni A. 2013. Developing logistic models to relate the accumulation of DON associated with Fusa rium head blight to climatic conditions in Europe. European Journal of Plant Pathology, 137, 689 706. Yoder W T, Christianson L M. 1998. Species-specific primers resolve members of Fusarium section Fusarium: Taxonomic stat us of the edible Quorn fungus reevaluated. Fungal Genetics and Biology, 23, 68 80. Young J C, Miller J D. 1985. Appearance of fungus, ergosterol and Fusarium mycotoxins in the husk, axial stem, and stalk afte r inoculation of field corn. Canadian Journal of Plant Science, 65, 47 53. (Managing editor ZHANG Juan)