VITROS MicroSlide Assay Summary

Similar documents
Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Part No. J04498 Cat No Performance Verifiers: Training Module

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018

Tables of Normal Values (As of February 2005)

Controls & Calibrators Clinical Chemistry

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

NORMAL LABORATORY VALUES FOR CHILDREN

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Authorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Analyte Specimen Demographic Reference Range Units

NEW RCPCH REFERENCE RANGES-

Types of target values, acceptable ranges

cobas c 501 analyzer and cobas c 311 analyzer Within Run Imprecision Guidelines

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

General Chemistry Scheme Guide

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.

Reagents on COBAS INTEGRA Systems

Serodos and Serodos plus

Rapid Laboratories In House Tests

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Roche/Hitachi - PreciControl ClinChem Multi 2

TRACEABILITY and UNCERTAINTY

Hamilton Regional Laboratory Medicine Program

Inspector's Accreditation Unit Activity Menu

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

TRACEABILITY and UNCERTAINTY

TRACEABILITY and UNCERTAINTY 7

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Biochemistry Adult Reference Ranges

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Hamilton Regional Laboratory Medicine Program

GRADING CRITERIA for CMS Regulated Analytes

COBAS INTEGRA / cobas c C.f.a.s.

Minimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections

Specimen Collection Requirements

Specimen Collection Requirements

BC Biomedical Laboratories Adult Reference Ranges

EASY. FAST. EFFICIENT.

DELIVERS MORE EASY FAST EFFICIENT. Linearity and Calibration Verification PRODUCT CATALOG

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

TRACEABILITY and UNCERTAINTY 9

VITROS MicroTip Assay Summary

CERTIFICATE OF ACCREDITATION

ENROLLMENT CONFIRMATION

Please contact the Client Services Team if you require further information.

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

S Potassium K mmol/l Up to 1m m - 1y >1y /07/2010. S Chloride CL mmol/l Up to 3m > 3m /07/2010

Supplementary materials

CERTIFICATE OF ACCREDITATION

10 Essential Blood Tests PART 1

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

To be used for the ease of test requisitioning on select patients only; all components may be ordered separately

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Test Result Reference Range Flag

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Delta Check Calculation Guide

Complete Medical History

LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1)

Breakout Session C: Harmonisation of the Alert Table.

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

CERTIFICATE OF ACCREDITATION

Understanding Blood Tests

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None

REAGENTS THE HIGHEST QUALITY RANGE OF ROUTINE AND NOVEL REAGENTS

CERTIFICATE OF ACCREDITATION

Clinician Blood Panel Results

Reference Intervals. Graham Jones / Gus Koerbin

Clinician Blood Panel Results

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Alaska Native Medical Center Anchorage, AK

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

Clinician Blood Panel Results

QUALITROL 2H Insert. 01 Inglês - Ref.: 72. Ref.:72. Precautions and warnings

LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and

LNA-mediated silencing of microrna-122 in African green monkeys

CLINICAL CHEMISTRY REAGENTS. Product Profile

BASIC METABOLIC PANEL

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

Postanalytical phase

Service Name SQ Test Code Specimen of Choice Minimum Volume Specimen Stability Testing Schedule Special Instructions SST / NAFL PLASMA

Uni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

Biochemistry Department Laboratory Handbook

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

EXAM COVER SHEET. Course Code: CLS 432. Course Description: Clinical Biochemistry. Final Exam. Duration: 2 hour. 1st semester 1432/1433.

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Transcription:

ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670 2 5 weeks Frozen 10 30 μg/ml 66 199 μmol/l Possible Toxicity: 150 200 μg/ml 992 1323 μmol/l Probable Toxicity: > 200 μg/ml > 1323 μmol/l 3.5 5.0 g/dl 35 50 g/l 630 1 1 week Frozen or Refrigerated ALC Alcohol ALKP Alkaline Phosphatase ALT Alanine Aminotransferase ALTV Alanine Aminotransferase Fluoride Oxalate EDTA 10 8 Liquid PV 7% BSA 11 3 PV 7% BSA 11 3 PV 7% BSA 7 3 PV 7% BSA 10 300 mg/dl 2.2 65.1 mmol/l (mmol/l = mg/dl x 0.217) Negative: <10 mg/dl Toxic: 50 100 mg/dl Depression of CNS: >100 mg/dl Fatalities Reported: >400 mg/dl <2 mmol/l 11 22 mmol/l >22 mmol/l 340 2 1 week Frozen >87 mmol/l 20 1500 U/L 38 126 U/L 400 2 2 weeks Frozen or Refrigerated 6 1000 U/L Adult: 4-750 U/L 13 69 U/L 9 52 U/L 21 72 U/L <35 U/L <50 U/L 340 2 4 weeks Frozen or Refrigerated 670 2 2 weeks Frozen or Refrigerated 3 months AMON Ammonia EDTA 10 5 Liquid PV 8.7 500.0 μmol/l 9 30 μmol/l 600 2 1 week Frozen Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 1

AMYL Amylase Urine 10 3 PV Specialty or low patient sample Isotonic saline 30 1200 U/L Adult: 30 110 U/L 540 1 2 weeks Frozen or 30 1200 U/L 32 641 U/L Refrigerated 4 weeks AST Aspartate Aminotransferase BuBc Bilirubin, unconjugated and conjugated BUN/UREA Blood Urea Nitrogen EDTA Urine (diluted) 7 3 PV 7% BSA 10 4 PV 7% BSA or normal patient sample 5.5 1 PV 7% BSA Isotonic saline 1 or 1 3.0 750.0 U/L Adult: Bu: 0.0 27.0 mg/dl 0 462 μmol/l Bc: 0.0 27.0 mg/dl 0 462 μmol/l (μmol/l = mg/dl x 17.1) 2.0 120.0 mg/dl (urea N) 0.71 42.83 mmol/l (urea) (mmol/l = mg/dl x 0.3569) 67 2520 mg/dl (urea N) 23.91 899.39 mmol/l (urea) after x21 dilution with water (mmol/l = mg/dl x 0.3569) Adult: Bu: 0.0 1.1 mg/dl Bc: 0.0 0.3 mg/dl Neonate: Bu: 0.6 10.5 mg/dl Bc: 0.0 0.6 mg/dl 9 20 mg/dl (urea N) 7 17 mg/dl (urea N) 12 20 g/day (urea N) 15 46 U/L 14 36 U/L 17 59 U/L 0 19 μmol/l 0 5 μmol/l 10 180 μmol/l 0 10 μmol/l 3.2 7.1 mmol/l (urea) 2.5 6.1 mmol/l (urea) 428 714 mmol/day (urea) 670 2 2 weeks Frozen or Refrigerated 3 months 400 & 460 1 2 weeks Frozen or Refrigerated 670 1 2 weeks Frozen or Refrigerated Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 2

Ca Calcium 10 1 PV Isotonic saline 1 or 1 or 1.00 14.00 mg/dl 0.25 3.49 mmol/l (mmol/l = mg/dl x 0.2495) 8.4 10.2 mg/dl 2.10 2.55 mmol/l 680 1 4 weeks Frozen or Refrigerated Urine (pretreated) 1 1.00 17.80 mg/dl 0.25 4.44 mmol/l (mmol/l = mg/dl x 0.2495) Ca-free: 5 40 mg/day Low to Average: 50 150 mg/day 0.13 1.00 mmol/day 1.25 3.75 mmol/day CHE Cholinesterase CHOL Cholesterol CK Creatine Kinase CKMB Creatine Kinase MB 2 11 6 PV 7% BSA 5.5 2 PV 7% BSA 11 3 PV or Isoenzyme PV Serum 11 6 Isoenzyme PV 7% BSA 7% BSA 0.20 12.50 U/mL 200 12500 U/L (U/L = U/mL x 1000) 50 325 mg/dl 1.29 8.40 mmol/l (mmol/l = mg/dl x 0.02586) Average: 100 300 mg/day 5.90 12.22 U/mL 4.65 10.44 U/mL Desirable: <200 mg/dl Borderline High: 200 239 mg/dl High: 240 mg/dl 20 1600 U/L 2.50 7.50 mmol/day 5900 12220 U/L 4650 10440 U/L <5.2 mmol/l 5.2 6.2 mmol/l 6.2 mmol/l 30 135 U/L 55 170 U/L 400 2 4 weeks Frozen 540 1 2 weeks Frozen or Refrigerated 6 months 670 2 1 week Frozen or Refrigerated 4 weeks 2.7 300.0 U/L Refer to the CKMB Instructions for Use sheet 670 2 1 week Frozen Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 3

Cl- Chloride CRBM Carbamazepine CREA Creatinine CRP C-Reactive Protein DGXN Digoxin dhdl Direct HDL Cholesterol dhdl Direct HDL Cholesterol (3200+) 10 2 PV Do not dilute 50.0 175.0 mmol/l Adult: 98 107 mmol/l N/A 1 2 weeks Frozen or Refrigerated Urine N/A 15 300 mmol/l Urine (Random): 18 209 mmol/l Urine (24-Hour): 110 250 mmol/day 11 9 TDM PV Do not dilute 3.0 20.0 μg/ml 12.7 84.6 μmol/l (μmol/l = μg/ml x 4.23) 6 1 PV 7% BSA Urine (diluted) 1 EDTA 11 7 CRP PV Specialty or low patient sample 11 9 PV or TDM PV 10 25 PV 7% BSA 6 25 PV 7% BSA 7% BSA 0.05 14.0 mg/dl 4 1238 μmol/l (μmol/l = mg/dl x 88.4) 1.2 346.5 mg/dl 106 30631 μmol/l after x21 dilution with water (μmol/l = mg/dl x 88.4 ) 5 90 mg/l 0.5 9.0 mg/dl (mg/dl = mg/l / 10) 0.40 4.00 ng/ml 0.51 5.12 nmol/l (nmol/l = ng/ml x 1.28) 5.0 110.0 mg/dl 0.13 2.84 mmol/l (mmol/l = mg/dl x 0.02586) 5.0 110.0 mg/dl 0.13 2.84 mmol/l (mmol/l = mg/dl x 0.02586) Therapeutic : 4.0 12.0 μg/ml 16.9 50.8 μmol/l 0.66 1.25 mg/dl 0.52 1.04 mg/dl 24 Hour 1000 2000 mg/day 58 110 μmol/l 46 92 μmol/l 8840 17680 μmol/day 670 1 1 week Frozen 670 2 2 weeks Frozen or Refrigerated 4 weeks 800 1800 mg/day 7072 15912 μmol/day <10 mg/l <1.0 mg/dl 670 1 48 hours Frozen Therapeutic : 0.8 2.0 ng/ml 1.0 2.6 nmol/l Low: <40.0 mg/dl High: 60.0 mg/dl Low: <40.0 mg/dl High: 60.0 mg/dl <1.03 mmol/l 1.55 mmol/l <1.03 mmol/l 1.55 mmol/l 670 1 1 week Frozen 670 1 7 days 670 1 7 days Frozen or Refrigerated 12 weeks Frozen or Refrigerated 12 weeks Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 4

ECO 2 Carbon Dioxide Fe Iron GGT Gamma Glutamyltrans- GLU Glucose ferase EDTA EDTA Sodium Fluoride/ Potassium oxalate Urine 6 2 PV Isotonic Saline 10 4 PV Iron-free reagentgrade water 11 3 PV 7% BSA 10 1 PV 7% BSA Isotonic saline or or 5.0 40.0 mmol/l 22 30 mmol/l 340 2 4 weeks Frozen or Refrigerated 10.1 600.0 μg/dl 1.81 107.46 μmol/l (μmol/l = μg/dl x 0.1791) 37 170 μg/dl 49 181 μg/dl 10 1400 U/L Adult: 20.0 625.0 mg/dl 1.11 34.69 mmol/l (mmol/l = mg/dl x 0.05551) 20.0 650.0 mg/dl 1.11 36.08 mmol/l (mmol/l = mg/dl x 0.05551) 6.6 30.4 μmol/l 8.8 32.4 μmol/l 12 58 U/L 12 43 U/L 15 73 U/L Fasting Adult: 74 106 mg/dl 4.1 5.9 mmol/l <500 mg/day Random: <30 mg/dl <2.8 mmol/day <1.7 mmol/l 600 2 4 weeks Frozen 400 2 4weeks Frozen or Refrigerated 540 2 1week Frozen or Refrigerated IMPORTANT When using sodium fluroride/potassium oxalate specimen type: Refrigerated 4 months K + CSF 2 2 Liquid PV 20.0 650.0 mg/dl 1.11 36.08 mmol/l (mmol/l = mg/dl x 0.05551) 10 2 PV Do not dilute 1.00 14.00 mmol/l Serum: Urine (diluted) Liquid PV 1 FS Pack 1 2.50 175.00 mmol/l after x5 dilution with UED 40 70 mg/dl 2.2 3.9 mmol/l 3.5 5.1 mmol/l Plasma: 0.1 0.7 mmol/l lower than serum range 25.0 125.0 mmol/day (diet dependent) N/A 1 2 weeks Frozen or Refrigerated Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 5

LAC Lactate LDH Lactate Dehydrogenase LDHI Lactate Dehydrogenase Li Lithium LIPA Lipase Mg Magnesium (keep whole blood on ice) Fluoride oxalate EDTA Urine (pretreated, diluted) 10 1 PV Isotonic saline or or 11 3 PV 7% BSA 11 3 PV 7% BSA 10 1 PV 7% BSA 5.5 3 PV 7% BSA 5 1 PV Isotonic saline or or 0.50 12.00 mmol/l 0.7 2.1 mmol/l 540 2 2 weeks Frozen 100 2150 U/L 313 618 U/L 340 2 2 weeks Frozen or Refrigerated 4 weeks 41 1000 U/L 120 246 U/L 340 2 2 weeks Frozen or Refrigerated 4 weeks 0.20 4.00 mmol/l Therapeutic: Potentially Toxic: Severely Toxic: 0.6 1.2 mmol/l >1.5 mmol/l >2.5 mmol/l 600 2 5 weeks 10 2000 U/L 23 300 U/L 540 1 1 week 0.20 10.0 mg/dl 0.08 4.11 mmol/l (mmol/l = mg/dl x 0.4114) 1.20 60.0 mg/dl 0.49 24.68 mmol/l after x6 dilution with water (mmol/l = mg/dl x 0.4114) Frozen Frozen 1.6 2.3 mg/dl 0.7 1.0 mmol/l 630 1 2 weeks Frozen 73.0 122.0 mg/day 3.0 5.0 mmol/day Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 6

Na + Sodium PHOS Phosphorous PHYT Phenytoin PROT Cerebrospinal Fluid Protein SALI Salicylate TBIL Total Bilirubin 10 2 PV Do not dilute 75.0 250.0 mmol/l 137 145 mmol/l N/A 1 10 days Urine (diluted) Liquid PV Urine (pretreated, diluted) FS Pack 1 10 1 PV Isotonic saline or or 1 11 9 PV or TDM PV 7% BSA CSF 10 5 Liquid PV Isotonic saline 10 1 Liquid PV 7% BSA 10 4 PV 5.0 250.0 mmol/l after x5 dilution with UED 0.50 13.00 mg/dl 0.16 4.20 mmol/l (mmol/l = mg/dl x 0.3229) 5.50 143.00 mg/dl 1.78 46.17 mmol/l after x11 dilution with water (mmol/l = mg/dl x 0.3229) 3.00 40.00 μg/ml 11.88 158.40 μmol/l (μmol/l = μg/ml x 3.96) 10 300 mg/dl 100 3000 mg/l (mg/l = mg/dl x 10) 1.0 40.0 mg/dl 0.07 2.90 mmol/l (mmol/l = mg/dl x 0.0724) 0.10 27.00 mg/dl 1.7 461.7 μmol/l (μmol/l = mg/dl x 17.1) Random: 40 220 mmol/day 30 90 mmol/l 2.5 4.5 mg/dl 0.81 1.45 mmol/l 680 or 670 24 hour: 0.4 1.3 g/day 12.9 42.0 mmol/day Therapeutic : 10.0 20.0 μg/ml 39.6 79.2 μmol/l CSF: 12 60 mg/dl 120 600 mg/l Negative: <2 mg/dl Therapeutic: <20 mg/dl Toxic: >30 mg/dl <0.1 mmol/l <1.5 mmol/l >2.2 mmol/l Lethal: >60 mg/dl >4.3 mmol/l 0.2 1.3 mg/dl 3 22 μmol/l 540 & 460 Frozen or Refrigerated 4 3 months 1 4 weeks Frozen or Refrigerated 670 1 1 week Frozen 670 2 1 week Frozen 540 2 5 weeks Frozen 1 2 weeks Frozen or Refrigerated Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 7

THEO Theophylline 10 1 PV 7% BSA 1.00 40.00 μg/ml 5.55 222.00 μmol/l (μmol/l = μg/ml x 5.55) 10.0 20.0 μg/ml 55.5 111.0 μmol/l 400 2 1 week Frozen TIBC Total Iron-Binding Capacity (pretreated) 10 4 PV Iron-free deionized Water 1 85 650 μg/dl 15.2 116.4 μmol/l (μmol/l = μg/dl x 0.1791) 261 462 μg/dl 265 497 μg/dl 46.8 82.7 μmol/l 47.4 89.0 μmol/l 600 Refer to Fe on page X5 TP Total Protein 10 4 PV Isotonic saline or or 2.00 11.00 g/dl 20.0 110.0 g/l (g/l = g/dl x 10.0) 6.3 8.2 g/dl 63 82 g/l 540 1 4 weeks Frozen or Refrigerated TP Total Protein (3200+) 6.5 4 PV Isotonic saline or or 2.00 11.00 g/dl 20.0 110.0 g/l (g/l = g/dl x 10.0) 6.3 8.2 g/dl 63 82 g/l 540 1 4 weeks Frozen or Refrigerated TRIG Triglyceride 5.5 2 PV 7% BSA 10.0 525.0 mg/dl 0.11 5.93 mmol/l (mmol/l = mg/dl x 0.01129) Normal: <150 mg/dl Borderline High: 150 199 mg/dl High: 200 499 mg/dl Very High: 500 mg/dl <1.69 mmol/l 1.69 2.25 mmol/l 2.26 5.64 mmol/l 5.65 mmol/l 540 1 1 week Frozen Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 8

UPRO Urine Protein Urine 10 10 UPRO PV 1 5 200 mg/dl 0.05 2.00 g/l (g/l = mg/dl x 0.01) Random: <12 mg/dl 42 225 mg/day <0.12 g/l 0.04 0.23 g/day 670 1 2 weeks Frozen URIC Uric Acid Urine (pretreated, diluted) 10 1 PV 7% BSA 1 0.50 17.00 mg/dl 29.7 1011.2 μmol/l (μmol/l = mg/dl x 59.48) 5.50 187.00 mg/dl 327.1 11122.8 μmol/l after x11 dilution with water (μmol/l = mg/dl x 59.48) 3.5 8.5 mg/dl 208 506 μmol/l 2.5 6.2 mg/dl 149 369 μmol/l 250 750 mg/day 1480 4430 μmol/day 670 1 2 weeks Frozen or Refrigerated Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 9

Derived Tests Test Calculation Test Calculation A/G Albumin/Globulin Ratio Alb / (TP - ALB) GLOB Globulin TP - ALB AGp Anion Gap without K + (Na + ) - (Cl - + ECO2) LDL Low Density Lipoprotein Conv. Units: (CHOL - HDLC) - ( TRIG/5) SI Units: (CHOL - HDLC) - ( TRIG/2.2) AGpK Anion Gap with K + (Na+ + K + ) - (Cl - + ECO2) NBil Neonatal Bilirubin Bu + Bc B/CR BUN/Creatinine Ratio BUN / CREA OSMO Osmolality (Na + x 1.86) + (GLU/18) + (BUN/2.8) C/H Cholesterol/HDLC Ratio CHOL / HDLC VLDL Very Low Density Lipoprotein DBIL Direct Bilirubin TBIL - Bu % MB CKMB/CK Ratio DELB Delta Bilirubin TBIL - (Bu + Bc) % Sat Percent Iron Saturation Conv. Units: TRIG/5 SI Units: TRIG /2.2 (CKMB/CK) x 100 (Fe/TIBC) x 100 Ortho-Clinical Diagnostics, Inc., 2017 VITROS is a registered trademark of Ortho-Clinical Diagnostics, Inc. 100 Indigo Creek Drive Rochester, NY 14626 10