Increased cystic fibrosis transmembrane conductance regulator (CFTR) expression in the human hydrosalpinx

Human Reproduction Vol.20, No.5 pp. 1228 1234, 2005 Advance Access publication February 10, 2005 doi:10.1093/humrep/deh773 Increased cystic fibrosis transmembrane conductance regulator (CFTR) expression in the human hydrosalpinx Louis Chukwuemeka Ajonuma 1, Ernest Hung Yu Ng 2, Pak Ham Chow 4, Cathy Yui Hung 4, Lai Ling Tsang 1, Annie Nga Yin Cheung 3, Christine Brito-Jones 5, Ingrid Hung Lok 5, Christopher J.Haines 5 and Hsiao Chang Chan 1,6 1 Epithelial Cell Biology Research Center, Department of Physiology, Faculty of Medicine, Chinese University of Hong Kong, Shatin, NT, Hong Kong, 2 Department of Obstetrics & Gynecology, 3 Department of Pathology, Faculty of Medicine, The University of Hong Kong, and 4 Department of Anatomy and 5 Department of Obstetrics & Gynecology, Faculty of Medicine, The Chinese University of Hong Kong, SAR, China 6 To whom correspondence should be addressed. E-mail: Hsiaocchan@cuhk.edu.hk BACKGROUND: Hydrosalpinx (HSP), characterized by abnormal fluid accumulation in the Fallopian tube, is one of the main causes of infertility in women; however, the mechanism underlying the formation of hydrosalpinx fluid (HF) remains elusive. The present study investigated the possible involvement of cystic fibrosis transmembrane conductance regulator (CFTR), a camp-dependent chloride channel, in the pathogenesis of hydrosalpinx. METHODS: Masson s trichrome staining was used to characterize epithelial transformation in human HSP; RT PCR, immunohistochemistry and immunofluorescence staining were used for CFTR expression and localization. RESULTS: Masson s trichrome staining showed areas of epithelial transformation, focally attenuated and pseudostratified. Immunostaining showed enhanced CFTR immunoreactivity in the focally attenuated and pseudostratified areas of HSP epithelium. RT PCR revealed that CFTR expression in HSP was significantly greater than that in normal Fallopian tubes. CONCLUSIONS: These results indicate that HSP epithelium undergoes epithelial transformation with elevated CFTR expression, which may lead to increased transepithelial electrolyte and fluid secretion resulting in HF formation. The present findings may lead to the development of new treatment strategies for infertile patients with HSP. Key words: CFTR/female reproductive tract/hydrosalpinx/hydrosalpinx fluid/infertility Introduction About 30% of infertile women seeking assisted reproductive treatments have hydrosalpinx (HSP) (Strandell et al., 1994; Blazar et al., 1997; Ng et al., 1997). Hydrosalpinx is detrimental to IVF outcome (Aboulghar et al., 1998; Strandell et al., 1998; Zeyneloglu et al., 1998; Camus et al., 1999). Hydrosalpinx fluid (HF) toxicity on mouse embryo development (Mukherjee et al., 1996; Bayler et al., 1997; Murray et al., 1997; Rawe et al., 1997: Sachdev et al., 1997; Koong et al., 1998; Spandorfer et al., 1999; Roberts et al., 1999; Carrasco et al., 2001; Arrighi et al., 2001) and human sperm (Ng et al., 2000) has also been documented. However, the molecular mechanism underlying the formation of HF is far from understood. In particular, the involvement of HSP epithelium has not been investigated although the secretory and absorptive activities of the epithelium have been considered to play a role (Ajonuma et al., 2002). Movement of ions across the tubal epithelium is essential for the movement of fluid, which is not actively transported but moves in response to osmotic gradients largely established by the transport of ions across epithelium, particularly Cl 2 ions through ion channels such as the cystic fibrosis transmembrane conductance regulator (CFTR), a campdependent Cl 2 channel located in the apical membrane and mainly responsible for Cl 2 secretion in many epithelia (Dickens and Leese, 1994; Quinton, 1999). CFTR has previously been shown to be expressed in the female reproductive tract of rodents (Rochwerger and Buchwald, 1993; Chan et al., 2002) and humans (Rochwerger and Buchwald, 1993; Tizzano et al., 1994). Previous studies from our laboratory have provided molecular and electrophysiological evidence of CFTR involvement in transepithelial fluid transport in the female reproductive tract of mice (Chan et al., 1999, 2002). Cyclic changes in uterine fluid volume have been explained by differential regulation of CFTR by ovarian hormones (Chan et al., 2002). The demonstration of camp-activated oviductal Cl 2 secretion in normal but not CFTR mutant mice (Leung et al., 1995) indicate a functional role of CFTR in oviductal secretory function. Therefore, it is likely that CFTR may play a crucial and important role in regulating fluid 1228 q The Author 2005. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Increased CFTR expression in hydrosalpinx balance in the Fallopian tubes and that abnormality of the tubal epithelium as in hydrosalpinx may lead to elevated CFTR expression, and thus HF formation. We undertook the present study to test this hypothesis by examining epithelial pathology and CFTR expression in the Fallopian tubes of infertile HSP patients seeking assisted reproduction treatments. Materials and methods Patients were recruited with ethical approval from the Ethics Committee of The Chinese University of Hong Kong. All patients gave written informed consent prior to their participation in this study. HSP was obtained from six patients undergoing laparoscopic bilateral salpingectomy because of visible HSP shown on transvaginal scanning during IVF cycles of infertile women who had tubal factor infertility only. Normal Fallopian tubes (NFT) were obtained from three healthy women of reproductive age who agreed to have laparoscopic bilateral salpingectomy for tubal sterilization. Salpingectomy was done during mid late proliferative stages (day 7 12) of their uterine cycles when CFTR expression is observed to be highest. Immediately after surgical removal, hydrosalpinges and NFT were collected into sterile tubes containing cold minimum essential medium (MEM; Life Technologies, Invitrogen, USA), placed on ice and transported to the laboratory. Masson s trichrome staining HSP and NFT tissue pieces were fixed overnight in 4% paraformaldehyde (Fisher brand, Fisher Scientific, USA). Tissue samples were dehydrated in graded ethanol and embedded in paraffin wax. Sections were cut at 5 mm using a Reichert Jung, Biocut Rotary Microtome 1130 (Germany), and dried unto Superfrost microscope slides (Fisher brand). Slides were dewaxed in xylene and redehydrated in graded alcohol and stained in Celestine Blue for 30 min and washed, stained again in Mayer s haematoxylin for another 30 min and washed in water. Slides were decolorized for a short time in acid alcohol and washed also in Scott s tap water. Slides were then stained in 1% Xylidine Ponceau in 0.5% HAC for 2 min and washed in water, and finally stained in 0.5% Fast Green for 20 s, blot dried, dehydrated in absolute alcohol, cleared and mounted using Permount (Fisher Scientific Fair Lawn, USA). Observation was done under inverted microscope (Leica; DMR BE, Germany). RNA extraction and RT PCR HSP and NFT were cut into small pieces after the removal of fatty tissues. Tissue pieces for RT PCR were immediately snap-frozen in liquid nitrogen and later stored at 280 8C until used. RNA was isolated from HSP and NFT small pieces using TRIzol reagent (Gibco Invitrogen, USA). RT PCR was performed and repeated three times using RNA obtained from small pieces of HSP and NFT. The specific oligonucleotide primers for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were: GTGGG- GCGCCCCAGGCACCA (sense) and CTCCTTAATGTCACGCAC- GATTTC (antisense), with expected cdna of 515 base pairs (bp). The specific oligonucleotide primers for human CFTR were: AGCT- GGACCAGACCAATTTTGAGGAAA (sense) and CCACACGAA- ATGTGCCAATGCAAGTCC (antisense), with expected cdna of 554 bp. The conditions were: denaturation at 94 8C for 45 s; annealing at 53 8C, 58 8C for 60 s; extension at 72 8C for 60 s; 30, 33 cycles for GAPDH and CFTR respectively. Optimal amplification cycles are determined based on the linear relationship between the amount of PCR product detected and the number of amplification cycles. Due to the relatively small number of samples and in order to minimize unnecessary variables, RNA obtained from all the samples for each group were polled together, reverse-transcribed and then used for PCR. The PCR products were analysed using 2% agarose gel electrophoresis stained with ethidium bromide and visualized in an UV-illuminated imager, Alpha Imager 2200 (Alpha Innotech Corporation, USA). The intensities of the bands of CFTR were normalized to that of GAPDH, which was amplified simultaneously and used as internal marker. Experiments in the absence of reverse transcriptase were conducted as negative control and experiments were repeated four times. Immunohistochemistry Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene and rehydrated in ethanol. Endogenous peroxidase activity was quenched using 3% hydrogen peroxide incubation for 30 min. The slides were then placed in a cooling jar with sodium citrate buffer (ph 6) for antigen retrieval for 5 min. After cooling, slides were rinsed in 1 phosphate-buffered saline (PBS) and incubated in normal blocking serum (Vectastain Elite ABC kit, Vector Laboratories, Inc., USA) for 30 min and washed with PBS. Slides were then incubated overnight with the primary antibody (CFTR, NeoMarkers, Lab Vision Corp., USA; 1:500 v/v in buffer) at 4 8C overnight. Tissue sections were then washed with PBS and immunostaining was performed using a biotinylated secondary antibody, a horseradish peroxidase H conjugate and a substrate chromogen mixture (Vectastain Elite ABC reagent: ABC kit). Reaction was revealed by incubation with vasoactive intestinal peptide (VIP) substrate (Vector Laboratories, Inc., USA) for another 15 min, rinsed in water and counterstained with haematoxylin (Merck, Germany). Tissue sections were dehydrated in graded ethanol, mounted with Permount (Fisher Scientific, USA) and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Intense purple colour deposits indicated the site of positive immunostaining. The experiment was repeated three times and negative controls were applied for all tissue sections by using normal serum and omitting the primary antibody. Three people who never took part in slide preparations evaluated the slides individually. Interpersonal variability was, 1%. CFTR immunostaining intensity values of NFT and HSP tissues were then analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA). Immunofluorescence staining Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene, rehydrated in graded ethanol and rinsed in tap water. Incubating slides in a solution of 0.3% hydrogen peroxide in water for 30 min quenched endogenous peroxidase activity. Then slides were washed in water and incubated in normal blocking serum (Vectastain Elite ABC kit) for another 30 min to block non-specific sites. Excess serum was removed from the slides by blotting and incubated overnight in primary antibody (CFTR1: 500 V/V in buffer, Neo Markers; Lab Vision Corp., USA) at 4 8C. Tissue sections were washed for 5 min three times with PBS and incubated for 30 min in a diluted biotinylated secondary antibody solution (Vectastain Elite ABC kit). Tissue sections were again washed for 5 min three times in PBS and incubated for 20 30 min in FITC-conjugated anti-mouse antibody (Vector Laboratories, Inc.), washed again in PBS, mounted with glycerol and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Three people who never took part in the slide preparation also evaluated the slides. Intensity values of immunofluores- 1229

L.C.Ajonuma et al. cence staining of NFT and HSP tissues were also analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA). Statistical analysis Data presented are mean (SEM) for the ratio of CFTR/GAPDH expression intensities as analysed using 2% agarose gel electrophoresis. Differences between groups were assessed using Mann Whitney U-test and analysis of variance (ANOVA) with Newman Keuls multiple comparison test for immunohistochemical staining intensity and immunofluorescence staining intensity values. P # 0.05 was considered significant. Statistical analysis was done using GraphPad Prism (GraphPad Software Inc., USA). Results Masson s trichrome staining Masson s trichrome staining allows one to distinguish clearly between muscles, connective tissue and epithelium. Masson s trichrome staining of HSP tissues showed extensive epithelial loss, areas of epithelial transformation (flattening of epithelial cells and cuboidal transformation), different degrees of focal attenuation (Figure 1a c) and pseudostratification (Figure 1d) of HSP epithelium. Immunolocalization of CFTR in hydrosalpinx We further compared the immunolocalization of CFTR protein in HSP and NFT. Immunoreactive CFTR, obtained using CFTR antibody and a VIP substrate kit, was detected strongly in the focally attenuated and pseudostratified areas of HSP epithelium (Figure 2). In the healthy Fallopian tubes, CFTR was localized on the apical side of luminal epithelium only (Figure 2b), while in hydrosalpinx it was found in both apical and basolateral surfaces of the pseudostratified (Figure 2c, d) and focally attenuated (Figure 2e, f) epithelium. Staining intensity of HSP was significantly different from those of NFT and controls (P, 0.0001, Figure 2g). Immunofluorescence staining further confirmed enhanced CFTR expression and abnormal localization in HSP (Figure 3). Densitometric measurements showed that the immunoreactive intensity in HSP was significantly different from that in NFT (P, 0.0001, Figure 3e). CFTR expression by RT PCR To further compare the expression of CFTR mrna in HSP and NFT, semi-quantitative RT PCR was performed using GAPDH (515 bp) as internal marker. The PCR products obtained were the expected molecular weight sizes of human CFTR (554 bp). CFTR expression, as shown by CFTR/GAPDH ratio, in HSP was significantly greater than that in NFT (P ¼ 0.0022, Figure 4). Discussion We have previously proposed that abnormalities in the transepithelial ion transport across HSP epithelium may be one of the important factors in the pathophysiology of post-infectious HF formation (Ajonuma et al., 2001). The present study has indeed confirmed epithelial transformation and upregulation of CFTR in HSP. Although extensive damage and loss of epithelial lining have been previously observed in HSP, areas of epithelial lining showing flattened and transformed epithelial cells have also been reported (David et al., 1969), consistent with our present observation. We have further demonstrated abnormality in CFTR expression and localization associated with the transformed epithelium in HSP. Instead of apical expression in the NFT, CFTR was predominantly found in the focally attenuated and pseudostratified areas of HSP epithelium. Elevated CFTR mrna expression in HSP was also demonstrated by semi-quantitative RT PCR. These data support the notion Figure 1. Masson s trichrome staining of hydrosalpinx (HSP) tissues showing extensive epithelial loss, areas of epithelial transformation (flattening of epithelial cells and cuboidal transformation), different degrees of focal attenuation (arrow, A C) and pseudostratification (arrows, D) of HSP epithelium. Magnification 40, bar ¼ 30 mm. L ¼ luminal epithelium. 1230

Increased CFTR expression in hydrosalpinx Figure 2. Immunohistochemical staining for cystic fibrosis transmembrane conductance regulator (CFTR) immunoreactivity on paraffin sections of normal Fallopian tubes (NFT) and hydrosalpinx (HSP). (A) Negative control, (B) apical localization of CFTR protein in NFT luminal epithelium (arrow). CFTR protein localization on the psudostratified (C, D) and focally attenuated (E, F) HSP epithelium. Magnification 40, bar ¼ 30 mm. Staining intensity measurements were done using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA) showed that the CFTR immuoreactive intensity in HSP was significantly different from that of NFT and control (*P, 0.0001, Newman Keuls, G). L ¼ luminal epithelium; CONT. ¼ negative control. that CFTR, as a Cl 2 channel, may play an important role in HF formation. Ion channels are membrane proteins that act as gated pathways for the movement of ions across cell membranes. Fluid movements across secretory epithelia are secondary to ion movements, particularly Cl 2. The importance of ion movements across epithelia lies in their coupling with the movement of water, which is not actively transported but moves in response to osmotic gradients established by the transport of ions (Leese, 1988). CFTR expression has been reported in the reproductive tissues of rodents (Rochwerger and Buchwald, 1993; Chan et al., 2002) and humans (Rochwerger and Buchwald, 1993; Tizzano et al., 1994); its regulation by ovarian hormones has been well documented (Rochwerger and Buchwald, 1993; Mularoni et al., 1995) and attributed to the cyclic changes in uterine fluid volume 1231

L.C.Ajonuma et al. Figure 3. Immunofluorescence staining of hydrosalpinx (HSP) paraffin sections showing cystic fibrosis transmembrane conductance regulator (CFTR) protein localization on the pseudostratified and focally attenuated HSP epithelium (A B); (C) apical localization of CFTR on normal Fallopian tubes (NFT) epithelium and D, negative control in which normal serum was used and CFTR antibody was omitted. Magnification 20, bar ¼ 30 mm. Densitometric measurements using Meta Morph image analysis software version 6.0 showed that CFTR immuoreactive intensity in HSP was significantly different from that in NFT (P, 0.0001, Figure 3E). L ¼ luminal epithelium. 1232 (Chan et al., 2002) since expression of CFTR is expected to lead to significant increase in the osmotic water permeability (Kunzelmann and Mall, 2002). Therefore, transformed epithelial cells with increased expression of CFTR in HSP, as observed in this study, may be one of the underlying mechanisms for abnormal fluid secretion and accumulation in the HSP lumen. Increased CFTR expression in HSP, significantly more than the expression in NFT during mid late proliferative stage of the uterine cycle, when CFTR expression is maximal, is also suggestive of increased fluid secretion. The abnormal fluid accumulation in HSP may also result from the indirect effect of CFTR as a regulator of other epithelial channels and transporters, such as water channels, protein (aquaporin AQP) and epithelial sodium channels (ENaC). Up-regulation of water channel (Kunzelmann and Schreiber, 1997; Kunzelmann, 1999) and inhibition of ENaC function, and thus fluid reabsorption (Stutts et al., 1995) by CFTR could both lead to a net accumulation of fluid in HSP. Although the reason for the increased expression of CFTR observed in HSP remains to be investigated further, one possible cause may be infection. Salpingitis and pelvic inflammatory disease (PID) precede HSP and our previous study demonstrated evidence of chronic ongoing low-grade infection in HSP (L.C.Ajonuma et al., unpublished data). It has been reported that bacterial infections up-regulate CFTR expression (Resta-Lenert and Barrett, 2002). Cytokines produced during infection, suggested to be contributory to the adverse effects of HF (David et al., 1969) such as interleukin 1 beta (IL-1b) are potent modulators of CFTR (Cafferata et al., 2000). During infection, bacteria binding may stimulate receptor signalling, leading to protein tyrosine phosphorylation, and finally increased CFTR expression. The significance of the presence of focally attenuated and pseudostratified epithelium in HSP is not clear at the moment. However, it has been reported that Chlamydial infection alters the transcription of host cell genes including those for cell differentiation, transcription factors and inhibition of apoptosis (Xia et al., 2003). Proliferating and dedifferentiating epithelial cells may show changes in their ion transport or channel expression. Recently, it has been demonstrated that enhanced camp-activated Cl 2 secretion in the hyperproliferative colonic mucosa was caused by elevated CFTR

Increased CFTR expression in hydrosalpinx Figure 4. Cystic fibrosis transmembrane conductance regulator (CFTR) mrna expression in hydrosalpinx tissues. Representative gel of 2% agarose gel electrophoresis of RT PCR products for CFTR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in NFT and HSP samples. Band for GAPDH corresponds to 515 bp whereas CFTR band corresponds to 554 bp (above). Densitometric units of (CFTR/GAPDH) ratio in both NFT and HSP PCR products. CFTR expression in HSP is significantly different from NFT (*P ¼ 0.0022) (below). expression (Umar et al., 2000). The epithelial changes seen in this study, possibly induced by Chlamydial chronic infection, may have contributed at least in part to the increased CFTR expression. It has also been demonstrated that C. trachomatis infection results in increased tyrosine phosphorylation of several host proteins including those involved in signal transduction pathways (Bliska et al., 1993; Brikeland et al., 1994; Fawaz et al., 1997; Xia et al., 2003). In fact, our preliminary data showed that C. trachomatis inoculated into healthy Sprague Dawley rat uteri induced uterine infection, massive uterine fluid accumulation (as in HSP) and increased CFTR mrna expression (Ajonuma et al., 2004), supporting the notion that infection may lead to up-regulation of CFTR with concomitant changes in ion flux across the apical membrane including hypersecretion of chloride ions and inhibition of sodium reabsorption, together contributing to the net increase in electrolytes in the Fallopian tube accompanied with increased fluid accumulation producing HSP. Accumulation of HF in the Fallopian tubes and its regurgitation into the uterine cavity may be a contributing factor for infertility observed in HSP patients, and impaired implantation or endometrium receptivity of transferred embryos during IVF (Mansour et al., 1991; Meyer et al., 1997). This is consistent with the present finding that CFTR is up-regulated in HSP. In fact, the observed improved IVF outcome in HSP patients pretreated with antibiotics (Sharara et al., 1996; Hurst et al., 2001) may be due to the return of CFTR expression back to the normal level when infection had subsided, leading to reduced HF reflux into the uterine cavity. Salpingectomy prior to IVF has been reported to be beneficial (Strandell et al., 1999, 2001; Johnson et al., 2002), and currently, salpingectomy for large hydrosalpinges prior to IVF is an accepted practice. However, most patients are reluctant to consent to this procedure, which is also reflected in the small sample numbers in our study. Whether this represents the general HSP, most or a particular HSP histological type remains to be evaluated further. If treatment with CFTR specific inhibitors in conjunction with antibiotics improves IVF and embryo transfer outcome in a clinical trial, it will certainly be a more attractive option to most patients than salpingectomy. Therefore, clinical applicability of CFTR-specific inhibitors with antibiotics as potential adjunct treatment for HSP should be evaluated. In summary, the present study has demonstrated for the first time epithelial transformation with increased CFTR expression in human HSP, thus providing a possible molecular mechanism of HF formation in HSP and infertility. These findings may lead to the development of a new treatment strategy for tubal factor infertile patients with HSP. Acknowledgements The strategic programme of the Chinese University of Hong Kong, Hong Kong supported this study. References Aboulghar MA, Mansour RT and Serour GI (1998) Controversies in the modern management of hydrosalpinx. Hum Reprod Update 4,882 890. Ajonuma LC, Haines CJ and Chan HC (2001) Hydrosalpinx fluid and in vitro mouse embryo development. J Obstet Gynaecol Res 27,237 239. Ajonuma LC, Ng EH-Y and Chan HC (2002) New insights into the mechanism underlying hydrosalpinx fluid and its adverse effect on IVF outcome. Hum Reprod Update 8,255 264. Ajonuma LC, Tsang LL, Ho LS, Chung YW, Chan PSK and Chan HC (2004) Chlamydia trachomatis induced cystic fibrosis transmembrane conductance regulator (CFTR) expression in rat uterus and human colonic T84 cells. Cell Biol Inter 28,S4. Arrighi CV, Lucas H, El-mowafi D, Campana A and Chardonnes D (2001) Effects of human hydrosalpinx fluid on in vitro murine fertilization. Hum Reprod 16,676 682. Bayler SA, James KP and Meyer WR (1997) Hydrosalpingeal fluid inhibits in vitro embryonic development in a murine model. Hum Reprod 12, 2724 2728. Birkelund S, Johnson H and Christiansen G (1994) Chlamydia trachomatis serovar L2 induces protein tyrosine phosphorylation during uptake by Hela Cells. Infect Immun 62,4900 4908. Blazar AS, Hogan JW, Seifer DB, Frishman GN, Wheeler CA and Haning RV (1997) The impact of hydrosalpinx on successful pregnancy in tubal factor infertility treated by in vitro fertilization. Fertil Steril 67,517 520. Bliska JB, Galan JE and Falkow S (1993) Signal transduction in the mammalian cell during bacteria attachment and entry. Cell 73,903 920. Cafferata EG, Gonzalez-Guerrico AM, Giordano L, Pivetta OH and Santa- Coloma TA (2000) Interleukin-1B regulates CFTR expression in human intestinal T84 cells. Biochim Biophys Acta 1500,241 248. Camus E, Poncelet C, Goffinet F, Wainer B, Merlet F, Nisand I and Philippe HJ (1999) Pregnancy rates after in-vitro fertilization in cases of tubal infertility with and without hydrosalpinx: a meta-analysis of published comparative studies. Hum Reprod 14,1243 1249. Carrasco I, Cebral E, Benitez R and Vantman D (2001) Hydrosalpinx fluid affects murine embryonic development in a coculture system with epithelial endometrial cells. Fertil Steril 75,1004 1008. Chan LN, Chung YW, Leung PS, Liu CQ and Chan HC (1999) Activation of an adenosine 3 0 5 0 -cyclic monophosphate-dependent Cl-conductance in response to neurohormonal stimuli in mouse endometrial epithelial cells: the role of cystic fibrosis transmembrane conductance regulator. Biol Reprod 60,374 380. 1233

L.C.Ajonuma et al. Chan LN, Rochelle LG, Boucher RC and Chan HC (2002) Distribution of epithelial sodium channels (ENaC) subunits and cystic fibrosis transmembrane conductance regulator (CFTR) in murine reproductive tract. J Membr Biol 185,165 176. David A, Garcia CR and Czernobilsky B (1969) Human hydrosalpinx: histologic study and chemical composition of fluid. Am J Obstet Gynecol 105,400 411. Dickens CJ and Leese HJ (1994) The regulation of rabbit oviduct fluid formation. J Reprod Fertil 100,377 381. Fawaz FS, Van ooij C and Homola E (1997) Infection with Chlamydia trachomatis altars the tyrosine phosphorylation and /or localization of several host Cell protein including contacting. Infect Immun 5301 5308. Hurst BS, Turker KE, Awoniyi CA and Schlaff WD (2001) Hydsrosalpinx treated with extended doxycycline does not compromise the success of in vitro fertilization. Fertil Steril 75,1017 1019. Johnson NP, Mak W and Sowter MC (2002) Laparoscopic salpingectomy for women with hydrosalpinges enhances the success of IVF: a Cochrane review. Hum Reprod 17,543 548. Koong MK, Jun JH, Song SJ, Lee HJ, Song IO and Kang IS (1998) A second look at the embryotoxicity of hydrosalpinx fluid: an in-vitro assessment in a murine model. Hum Reprod 13,1620 1624. Kunzelmann K (1999) The cystic fibrosis transmembrane conductance regulator and its function in epithelial transport. Rev Physiol Biochem Pharmacol 137,1 70. Kunzelmann K and Mall M (2002) Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev 82,245 280. Kunzelmann K and Schreiber R (1997) CFTR, a regulator of channels. J Membr Biol 168,1 8. Leese HJ (1988) The formation and function of oviduct fluid. J Reprod Fertil 82,843 856. Leung AY, Wong PY, Gabriel SE, Yankaskas JR and Boucher RC (1995) camp-but not Ca 2þ -regulated Cl conductance in the oviductuct is defect in mouse model of cystic fibrosis. Am J Physiol. 268,C708 C712. Mansour R, Aboulghar M, Serour G and Riad R (1991) Fluid accumulation of the uterine cavity before embryo transfer: a possible hindrance for implantation. J In Vitro Fertil Embryo Transfer 8,157 159. Meyer WR, Castelbaum AJ, Somkuti S, Sagoskin AW, Doyle M, Harris JE and Lessey BA (1997) Hydrosalpinges adversely affects markers of endometrial receptivity. Hum Reprod 12,1393 1398. Mukherjee T, Copperman AB, McCaffrey C, Cook CA, Bustillo M and Obasaju MF (1996) Hydrosalpinx fluid has embryotoxic effects on murine embryogenesis: a case for prophylactic salpingectomy. Fertil Steril 66,851 853. Mularoni A, Beck L, Sadir R, Adessi GL and Nicollier M (1995) Downregulation by progesterone of CFTR expression in endometrial epithelial cells: a study by competitive RT-PCR. Biochem Biophy Res Commun 217,1105 1111. Murray CA, Clarke HJ, Tulandi T and Tan SL (1997) Inhibitory effect of human hydrosalpingeal fluid on mouth preimplantation embryonic development is significantly reduced by the addition of lactate. Hum Reprod 11,2504 2507. Ng EH, Yeung WS and Ho PC (1997) The presence of hydrosalpinx may not adversely affect the implantation and pregnancy rates in in vitro fertilization treatment. J Assist Reprod Genet 14,508 512. Ng EHY, Ajonuma LC, Lau EYL, Yeung WSB and Ho PC (2000) Adverse effects of hydrosalpinx fluid on sperm motility and survival. Hum Reprod 15,772 777. Quinton PM (1999) Physiological basis of cystic fibrosis: a historical perspective. Physiol Rev 79,S3 S22. Rawe VJ, Liu J, Shaffer S et al. (1997) Effect of human hydrosalpinx fluid on murine embryo development and implantation. Fertil Steril 68, 668 670. Resta-Lenert S and Barett KE (2002) Enteroinvasive bacteria alter barrier and transport properties of human intestinal epithelium: role of inos and COX-2. Gastroenterology 122,1070 1087. Roberts JE, Clarke HJ, Tulandi T and Tan SL (1999) Effects of hydrosalpingeal fluid on murine embryo development and implantation. J Assist Reprod Genet 16,421 424. Rochwerger L and Buchwald M (1993) Stimulation of the cystic fibrosis transmembrane conductance regulator expression by estrogen in vivo. Endocrinology 133,921 930. Sachdev R, Kemmann E, Bohrer MK and El-Danasouri I (1997) Detrimental effect of hydrosalpinx fluid on the development and blastulation of mouse embryos in vitro. Fertil Steril 68,531 533. Sharara FI, Scott RT, Jr, Marut EL and Queenan JT, Jr (1996) In-vitro fertilization outcome in women with hydrosalpinx. Hum Reprod 11,526 530. Spandorfer SD, Liu HC, Neuer A, Barmat LI, Davis O and Rosenwaks Z (1999) The embryo toxicity of hydrosalpinx fluid is only apparent at high concentrations: an in vitro model that simulates in vivo events. Fertil Steril 71,619 626. Strandell A, Waldenstrom U, Nilsson L and Hamberger L (1994) Hydrosalpinx reduces in-vitro fertilization/embryo transfer pregnancy rates. Hum Reprod 9,861 863. Strandell A, Sjogren A, Bentin-Ley U, Thorburn J and Hamberger L (1998) Hydrosalpinx fluid does not adversely affect the normal development of human embryos and implantation in vitro. Hum Reprod 13,2921 2925. Strandell A, Lindhard A, Waldenstrom U, Thorburn J, Janson PO and Hanberger L (1999) Hydrosalpinx and IVF outcome: a prospective, randomized multicenter trial in Scandinavia on salpingectomy prior to IVF. Hum Reprod 14,2762 2769. Strandell A, Lindhard A, Waldenstrom U and Thorburn J (2001) Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial. Hum Reprod 16,2403 2410. Stutts MJ, Canesasa MC, Olsen JC, Hamrick JA, Rossier BC and Boucher RC (1995) CFTR as a camp-dependent regulator of sodium channels. Science 269,847 850. Tizzano EF, Silver MM, Chitayat D, Benichou JC and Buchwald M (1994) Differential cellular expression of cystic fibrosis transmembrane regulation in human reproductive tissues. Clues for the infertility in patients with cystic fibrosis. Am J Pathol 144,906 914. Umar S, Scott J, Sellin JH, Dubinsky WP and Morris AP (2000) Murine colonic mucosa hyperproliferation. Elevated CFTR expression and enhanced camp-dependent Cl 2 secretion. Am J Physiol Gastrointest Liver Physiol 278,G753 G764. Xia MS, Bumgarner RE, Lampe MF and Stamm WE (2003) Chlamydia trachomatis infection alters host cell transcription in diverse cellular pathways. J Infect Dis 187,424 434. Zeyneloglu HB, Arici A and Olive DL (1998) Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization-embryo transfer. Fertil Steril 70,492 499. Submitted on February 20, 2004; resubmitted on January 04, 2005; accepted on January 10, 2005 1234