Treating Higher-Risk MDS Eyal Attar, M.D. Massachusetts General Hospital Cancer Center eattar@partners.org 617-724-1124 Case presentation 72 year old man, prior acoustic neuroma WBC (X10 3 /ul) 11/08 12/08 3/09 7/09 2/10 Rx 4/10 8/10 10/10 12/10 4.93 5.17 4.0 3.2 4.5 5.7 6.2 6.5 7.3 HCT (%) 39.4 39.1 37 29.5 25.7 27 27 28 27 Plts (K) 107 116 82 42 25 24 22 23 34 Dysplasia My, My, E, Blasts (%) 8 5 26 16 10 19 24 Defining higher risk MDS IPSS WHO IPSS: WPSS MD Anderson PSS 1
International Prognosis Scoring System (IPSS) Score Score 0 0.5 1.0 1.5 2.0 % BM blasts <5 5-10 - 11-20 21-30 Karyotype Good (NL, Y-, 5q-, 20q-) Intermediat e (all others) Poor (complex, Chr 7) - - Cytopenias 0/1 2/3 - - - RBC HgB < 10 WBC ANC<1800 Plt <100K Greenberg, et. al, Blood, 1997; 9:2079 Score Overall Median Survival, years IPSS Time to 25% of patients tx to AML, years Low 0 5.7 9.4 Int-1 0.5-1.0 3.5 3.3 Int-2 1.5-2.0 1.2 1.1 High 2.5-3.5 0.4 0.2 Greenberg, et. al, Blood, 1997; 9:2079 WPSS (Dynamic) Very low: 0 Low: 1 Int: 2 High: 3-4 Very high: 5-6 Malcovati L, et al., J Clin Oncol., 2007 2
MD Anderson Prognostic Scoring System Risk category Score % patients Median survival (Months) % alive at 3 years % alive at 6 years Low 0-4 16 54 63 38 Int-1 5-6 24 25 34 13 Int-2 7-8 24 14 16 6 High 9-15 36 6 4 0.4 Performance status, Age, Platelet count, Hemoglobin, Bone marrow blast %, WBC >20 x 109/L, Karyotype chromosome 7 abnormality or complex 3 abnormalities, Prior transfusion Kantarjian H, et al., Cancer, 2008 Why do we care about low vs high risk? Risk QoL Transfusions, clinic visit, hospitalizations, infections Longevity What s my doctor thinking? How strong is this person? How much treatment can they REALLY take? How much chemotherapy do they really want? What s driving them to live? What kind of supports do they have in place? 3
What s my doctor thinking? Has the person been treated with chemotherapy or radiation in the past? What are the kinetics of the disease? How fast is it coming on? How far do they live from a treatment center and how motivated are they to come for treatment? What s my doctor thinking? How many blasts are in the marrow? What are the cytogenetics? How well does this person understand the treatment options I m presenting? Is it the right time to discuss end of life issues? Treatment Goals Control symptoms due to cytopenias Improve QoL, minimize therapy-related toxicities Improve overall survival Prevent/delay progression to AML 4
MDS Treatment Options FDA-approved medications azacitidine (Vidaza) lenalidomide (Revlimid) decitabine (Dacogen) Clinical Trial Allogeneic stem cell transplantation MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Most patients Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Few patients Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy 5
MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Some patients Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy MDS: Supportive Care Erythroid growth factors Epoetin alfa (Procrit) 40,000-120,000 units SC q week Darbepoetin alfa (Aranesp) 200 ug SC q 1-2 weeks Myeloid growth factors Filgrastim (Neupogen) 300 ug SC q week q day Blood products RBCs (with consideration of Fe-chelation therapy) Plts Antibiotics Is a stem cell transplant possible? Even a small chance?, possibly Goals Maintain or increase QoL Prolong life Cytoreduce Blasts, definitely Transplant High: cytoreduce Low: get me to transplant! 6
Is a stem cell transplant possible? Even a small chance? What might treatment look like? A A B C D, possibly A, low dose Transplant A, high dose Transplant A, low B, high Transplant, definitely Arrange transplant Transplant A, low dose Transplant A, high dose Transplant A, low B, high Transplant Therapies for High-Risk MDS Hypomethylating agents azacitidine, decitabine IMIDs lenalidomide, thalidomide Induction chemotherapy cytarabine, anthracycline (idarubicin, daunorubicin) s Allogeneic stem cell transplantation Hypomethylating agents Why do we think they work? DNA is overmethylated in MDS and AML Before chemotherapy Me Me Gene transcription blocked AAGTCGCGCGATGCATGGCT tumor suppressor gene, cell cycle arrest gene After chemotherapy Me Me Gene transcription back on AAGTCGDGVGATGCATGGCT tumor suppressor gene, cell cycle arrest gene 7
SC Hypomethylating agents: How are they given? VVVVVVV every 4 weeks IV VVVVV every 4 weeks IV IV D 8 D 8 D 8 DDDDD every 6 weeks every 4 weeks Hypomethylating agents Goals prolong survival delay development of AML How do we know if they work? QoL improves Less transfusions Blasts decrease Survival Study Screening/Central Pathology Review Investigator CCR Tx Selection Randomization BSC was included with each arm AZA 75 mg/m 2 /d x 7 d q28 d CCR Best Supportive Care (BSC) only Low Dose Ara-C (LDAC, 20 mg/m 2 /d x 14 d q28-42 d) Std Chemo (7 + 3) Fenaux P, et al., Lancet Oncol., 2009 8
Proportion Surviving Parameter Age (yrs) Median Pts 65 (%) FAB (%) IPSS (%) Baseline Clinical Characteristics N = 358 RAEB RAEB-T CMML INT-1 INT-2 High AZA N=179 69 68 58 34 3 3 43 46 CCR N=179 70 76 58 35 3 7 39 48 BSC Only N=105 70 77 65 29 4 9 44 44 CCR Regimens LDAC N=49 71 86 51 39 2 4 43 43 Std Chemo N=25 65 52 40 52 0 8 12 72 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Overall Survival: vs CCR ITT Population 15 months Log-Rank p=0.0001 HR = 0.58 [95% CI: 0.43, 0.77] Deaths: AZA = 82, CCR = 113 Difference: 9.4 months 50.8% 24.4 months 26.2% 0.0 0 5 10 15 20 25 30 35 40 Time (months) from Randomization AZA CCR Comparison of BSC vs decitabine 233 patients 60-90 years old, median age 70 Ineligible for intensive therapy 15 mg/m2 every 8 hours for 3 every 6 weeks OS prolongation with decitabine versus BSC was not statistically significant (median OS, 10.1 v 8.5 months, P =.38) Progression-free survival (PFS), but not acute myeloid leukemia (AML) -free survival (AMLFS), was significantly prolonged with decitabine versus BSC (median PFS, 6.6 v 3.0 months; P =.004; median AMLFS, 8.8 v 6.1 months, respectively; P =.24). AML transformation was significantly (P =.036) reduced at 1 year (from 33% with BSC to 22% with decitabine). CONCLUSION resulted in improvements of OS and AMLFS (nonsignificant), of PFS and AML transformation (significant), and of QOL. Lubbert M, et al., J Clin Oncol., 2011 9
Comparison of BSC vs decitabine Lubbert M, et al., J Clin Oncol., 2011 Intensive chemotherapy IVB IVCI AAA CCCCCCC wait 2 weeks Repeat if necessary A=anthracycline, C=cytarabine Limitations Low remission rate high morbidity/mortality 4-6 week hospitalization Autologous Transplant: Own Stem Cells Neupogen Freeze Wait 1-2 weeks Defrost and infuse stem cells Chemotherapy +/- radiation Recovery, 3-4 weeks 10
Allogeneic Transplant: Another Person s Stem Cells Neupogen Donor Donor and patient treatments occur simultaneously Infuse fresh stem cells Chemotherapy +/- radiation Recovery, 3-4 weeks Full Allogeneic Transplant: Mini vs. Full High-dose chemotherapy +/- radiation Recovery, 3-4 weeks Eradicate malignancy converts to donor blood type Intense High treatmentrelated mortality rate Graft-versushost disease Mini Low-dose chemotherapy Recovery, 3-4 weeks Create space for donor blood: chimerism Safer Graft-versushost disease Mini-Transplants: Chimerism Copeland E., NEJM, 2006, 1813-26. 11
Gain/Loss of Discounted Life Expectancy Overall Survival (%) Overall Survival (%) Allogeneic Stem Cell Transplant in s With MDS Allogeneic SCT is the only potentially curative therapy for MDS Up to 50% long term survival rate Allogeneic SCT appropriate for <5-10% of MDS patients Adequate performance status Appropriately matched donor Morbidity and mortality increases with age n-myeloablative SCT for older patients Deeg HJ et al. Blood. 2000;95:1188 Cutler CS et al. Blood. 2004;104:579 Survival by IPSS Risk in s Who Did or Did t Undergo Transplantation 100 75 Transplant 50 Low 25 0 High Int-2 Int-1 0 25 50 75 100 125 150 175 200 225 100 Months 75 50 25 0 Low Int-1 High Int-2 Transplant 0 25 50 75 100 125 150 175 200 225 Months Cutler CS et al. Blood. 2004;104:579 Effect of Delaying Transplantation by IPSS Risk 1.5 1 0.5 0-0.5-1 -1.5-2 -2.5 Low Int-1 Years of Delay 1 2 3 4 5 6 7 8 9 10 High Int-2 Cutler CS et al. Blood. 2004;104:579 12
Clinical Trials www.clinicaltrials.gov 1319 studies 462 studies recruiting What to use after azacitidine Plts stimulation GST inhibition CXCR4 modulation Combination therapies WBC (X10 3 /ul) More genetically complex than we realize 11/08 12/08 3/09 7/09 2/10 Rx 4/10 8/10 10/10 12/10 4.93 5.17 4.0 3.2 4.5 5.7 6.2 6.5 7.3 HCT (%) 39.4 39.1 37 29.5 25.7 27 27 28 27 Plts (K) 107 116 82 42 25 24 22 23 34 Dysplasia My, My, E, Blasts (%) 8 5 26 16 10 19 24 Cytogenetics NL NL NL NL NL NL NL Mutations 13 13 13 Conclusions Higher risk disease defined by increased blasts adverse cytogenetics lower blood counts Treatments hypomethylating agents intensive chemotherapy allogeneic SCT clinical trials 13